From f65c2e5c84e24ad3a2bb614d899dbe176141104c Mon Sep 17 00:00:00 2001 From: Aviu00 <93730715+Aviu00@users.noreply.github.com> Date: Mon, 22 Jul 2024 17:06:02 +0000 Subject: [PATCH 1/6] Flashbang tweaks. (#478) * - tweak: Flashbang tweaks. * - add: More flashbang stuff. --- Content.Server/Flash/FlashSystem.cs | 4 ++- .../Standing/StandingStateComponent.cs | 4 +-- .../FlashSoundSuppressionComponent.cs | 3 ++- .../FlashSoundSuppressionSystem.cs | 25 +++++++++++++------ .../Entities/Clothing/Ears/headsets_alt.yml | 2 +- .../Clothing/Head/hardsuit-helmets.yml | 24 +++++++++++++++--- .../Entities/Clothing/Head/hive_head.yml | 1 + 7 files changed, 47 insertions(+), 16 deletions(-) diff --git a/Content.Server/Flash/FlashSystem.cs b/Content.Server/Flash/FlashSystem.cs index 2e5a713192..9dbc9c76ff 100644 --- a/Content.Server/Flash/FlashSystem.cs +++ b/Content.Server/Flash/FlashSystem.cs @@ -179,8 +179,10 @@ namespace Content.Server.Flash // They shouldn't have flash removed in between right? Flash(entity, user, source, duration, slowTo, displayPopup); + var distance = (mapPosition.Position - _transform.GetMapCoordinates(entity).Position).Length(); + if (forceStun) // WD - _flashSoundSuppressionSystem.Stun(entity, duration); + _flashSoundSuppressionSystem.Stun(entity, duration, distance, range); } _audio.PlayPvs(sound, source, AudioParams.Default.WithVolume(1f).WithMaxDistance(3f)); diff --git a/Content.Shared/Standing/StandingStateComponent.cs b/Content.Shared/Standing/StandingStateComponent.cs index 7af773cdb7..c7233bc42f 100644 --- a/Content.Shared/Standing/StandingStateComponent.cs +++ b/Content.Shared/Standing/StandingStateComponent.cs @@ -23,11 +23,11 @@ namespace Content.Shared.Standing // WD EDIT [DataField, AutoNetworkedField, ViewVariables(VVAccess.ReadWrite)] - public bool CanLieDown = false; + public bool CanLieDown; // WD EDIT [DataField, AutoNetworkedField, ViewVariables(VVAccess.ReadWrite)] - public bool AutoGetUp = false; + public bool AutoGetUp = true; /// /// List of fixtures that had their collision mask changed when the entity was downed. diff --git a/Content.Shared/_White/BuffedFlashGrenade/FlashSoundSuppressionComponent.cs b/Content.Shared/_White/BuffedFlashGrenade/FlashSoundSuppressionComponent.cs index 190af15af6..467ac826b7 100644 --- a/Content.Shared/_White/BuffedFlashGrenade/FlashSoundSuppressionComponent.cs +++ b/Content.Shared/_White/BuffedFlashGrenade/FlashSoundSuppressionComponent.cs @@ -5,5 +5,6 @@ namespace Content.Shared._White.BuffedFlashGrenade; [RegisterComponent, NetworkedComponent] public sealed partial class FlashSoundSuppressionComponent : Component { - + [DataField, ViewVariables(VVAccess.ReadWrite)] + public float MaxRange = 3f; } diff --git a/Content.Shared/_White/BuffedFlashGrenade/FlashSoundSuppressionSystem.cs b/Content.Shared/_White/BuffedFlashGrenade/FlashSoundSuppressionSystem.cs index c04d650fa0..354c7b3352 100644 --- a/Content.Shared/_White/BuffedFlashGrenade/FlashSoundSuppressionSystem.cs +++ b/Content.Shared/_White/BuffedFlashGrenade/FlashSoundSuppressionSystem.cs @@ -18,26 +18,37 @@ public sealed class FlashSoundSuppressionSystem : EntitySystem private void OnGetFlashbanged(Entity ent, ref InventoryRelayedEvent args) { - args.Args.Protected = true; + args.Args.MaxRange = MathF.Min(args.Args.MaxRange, ent.Comp.MaxRange); } - public void Stun(EntityUid target, float duration) + public void Stun(EntityUid target, float duration, float distance, float range) { - if (HasComp(target)) - return; + if (TryComp(target, out var suppression)) + range = MathF.Min(range, suppression.MaxRange); var ev = new GetFlashbangedEvent(); + ev.MaxRange = range; RaiseLocalEvent(target, ev); - if (ev.Protected) + range = MathF.Min(range, ev.MaxRange); + + if (range <= 0f) + return; + if (distance < 0f) + distance = 0f; + if (distance > range) return; - _stunSystem.TryParalyze(target, TimeSpan.FromSeconds(duration / 1000f), true); + var stunTime = float.Lerp(duration, 0f, distance / range); + if (stunTime <= 0f) + return; + + _stunSystem.TryParalyze(target, TimeSpan.FromSeconds(stunTime / 1000f), true); } } public sealed class GetFlashbangedEvent : EntityEventArgs, IInventoryRelayEvent { - public bool Protected; + public float MaxRange = 7f; public SlotFlags TargetSlots => SlotFlags.EARS | SlotFlags.HEAD; } diff --git a/Resources/Prototypes/Entities/Clothing/Ears/headsets_alt.yml b/Resources/Prototypes/Entities/Clothing/Ears/headsets_alt.yml index 07247d66ef..4e0744b023 100644 --- a/Resources/Prototypes/Entities/Clothing/Ears/headsets_alt.yml +++ b/Resources/Prototypes/Entities/Clothing/Ears/headsets_alt.yml @@ -9,7 +9,7 @@ state: icon_alt - type: Clothing equippedPrefix: alt - - type: FlashSoundSuppression # WD + - type: FlashSoundSuppression - type: entity parent: ClothingHeadsetAlt diff --git a/Resources/Prototypes/Entities/Clothing/Head/hardsuit-helmets.yml b/Resources/Prototypes/Entities/Clothing/Head/hardsuit-helmets.yml index 46aacbaa80..1efe876218 100644 --- a/Resources/Prototypes/Entities/Clothing/Head/hardsuit-helmets.yml +++ b/Resources/Prototypes/Entities/Clothing/Head/hardsuit-helmets.yml @@ -185,7 +185,7 @@ Piercing: 0.9 Heat: 0.9 - type: FlashImmunity # WD edit - - type: FlashSoundSuppression # WD edit + - type: FlashSoundSuppression #Brigmedic Hardsuit - type: entity @@ -214,7 +214,7 @@ highPressureMultiplier: 0.6 lowPressureMultiplier: 1000 - type: FlashImmunity # WD edit - - type: FlashSoundSuppression # WD edit + - type: FlashSoundSuppression #Warden's Hardsuit - type: entity @@ -241,7 +241,7 @@ Piercing: 0.9 Heat: 0.9 - type: FlashImmunity # WD edit - - type: FlashSoundSuppression # WD edit + - type: FlashSoundSuppression #Captain's Hardsuit - type: entity @@ -259,7 +259,7 @@ highPressureMultiplier: 0.3 lowPressureMultiplier: 1000 - type: FlashImmunity # WD edit - - type: FlashSoundSuppression # WD edit + - type: FlashSoundSuppression #Inspector's Hardsuit - type: entity @@ -423,6 +423,7 @@ Heat: 0.9 - type: EyeProtection # WD edit - type: FlashImmunity # WD + - type: FlashSoundSuppression #Blood-red Medic Hardsuit - type: entity @@ -450,6 +451,7 @@ Heat: 0.9 - type: EyeProtection # WD edit - type: FlashImmunity # WD + - type: FlashSoundSuppression #Syndicate Elite Hardsuit - type: entity @@ -479,6 +481,7 @@ Heat: 0.9 - type: EyeProtection # WD edit - type: FlashImmunity # WD + - type: FlashSoundSuppression #Syndicate Commander Hardsuit - type: entity @@ -506,6 +509,7 @@ Heat: 0.9 - type: EyeProtection # WD edit - type: FlashImmunity # WD + - type: FlashSoundSuppression #Cybersun Juggernaut Hardsuit - type: entity @@ -531,6 +535,7 @@ Heat: 0.9 - type: EyeProtection # WD edit - type: FlashImmunity # WD + - type: FlashSoundSuppression #Wizard Hardsuit - type: entity @@ -557,6 +562,9 @@ Piercing: 0.9 Heat: 0.9 - type: WizardClothes + - type: EyeProtection + - type: FlashImmunity + - type: FlashSoundSuppression #Organic Space Suit - type: entity @@ -632,6 +640,7 @@ Heat: 0.9 - type: EyeProtection # WD edit - type: FlashImmunity # WD + - type: FlashSoundSuppression #ERT Chaplain Hardsuit - type: entity @@ -672,6 +681,7 @@ - type: EyeProtection # WD edit - type: FlashImmunity # WD + - type: FlashSoundSuppression #ERT Medical Hardsuit - type: entity parent: ClothingHeadHelmetHardsuitSyndieElite @@ -688,6 +698,7 @@ color: "#adffec" - type: EyeProtection # WD edit - type: FlashImmunity # WD + - type: FlashSoundSuppression #ERT Security Hardsuit - type: entity @@ -712,6 +723,7 @@ Heat: 0.9 - type: EyeProtection # WD edit - type: FlashImmunity # WD + - type: FlashSoundSuppression #ERT Janitor Hardsuit - type: entity @@ -729,6 +741,7 @@ color: "#cbadff" - type: EyeProtection # WD edit - type: FlashImmunity # WD + - type: FlashSoundSuppression #CBURN Hardsuit - type: entity @@ -770,6 +783,7 @@ Heat: 0.9 - type: EyeProtection # WD edit - type: FlashImmunity # WD + - type: FlashSoundSuppression #Deathsquad Hardsuit - type: entity @@ -797,6 +811,8 @@ Caustic: 0.95 - type: EyeProtection # WD edit - type: FlashImmunity # WD + - type: FlashSoundSuppression + maxRange: 0 - type: ShowHealthBars damageContainers: - Biological diff --git a/Resources/Prototypes/_White/Entities/Clothing/Head/hive_head.yml b/Resources/Prototypes/_White/Entities/Clothing/Head/hive_head.yml index c4b5c6ddf6..4a14e07660 100644 --- a/Resources/Prototypes/_White/Entities/Clothing/Head/hive_head.yml +++ b/Resources/Prototypes/_White/Entities/Clothing/Head/hive_head.yml @@ -20,6 +20,7 @@ - type: DeleteOnChangelingRefund - type: FlashImmunity - type: EyeProtection + - type: FlashSoundSuppression - type: HiveHead - type: entity From 2f998722de16c87a46eb35cd3dd35123eb50ed14 Mon Sep 17 00:00:00 2001 From: RavmorganButOnCocaine Date: Mon, 22 Jul 2024 17:07:05 +0000 Subject: [PATCH 2/6] Automatic changelog update --- Resources/Changelog/ChangelogWhite.yml | 27 ++++++++++++++++++++++++++ 1 file changed, 27 insertions(+) diff --git a/Resources/Changelog/ChangelogWhite.yml b/Resources/Changelog/ChangelogWhite.yml index ebb7adc9e5..e636ad0148 100644 --- a/Resources/Changelog/ChangelogWhite.yml +++ b/Resources/Changelog/ChangelogWhite.yml @@ -6425,3 +6425,30 @@ id: 408 time: '2024-07-22T14:24:00.0000000+00:00' url: https://api.github.com/repos/frosty-dev/ss14-core/pulls/477 +- author: Aviu + changes: + - message: "\u0422\u0435\u043F\u0435\u0440\u044C \u043F\u043E\u043B\u043D\u043E\u0440\ + \u0430\u0437\u043C\u0435\u0440\u043D\u0430\u044F \u0433\u0430\u0440\u043D\u0438\ + \u0442\u0443\u0440\u0430 \u0438 \u0448\u043B\u0435\u043C\u044B \u0441\u043A\u0430\ + \u0444\u0430\u043D\u0434\u0440\u043E\u0432 \u0442\u043E\u043B\u044C\u043A\u043E\ + \ \u0447\u0430\u0441\u0442\u0438\u0447\u043D\u043E \u0437\u0430\u0449\u0438\u0449\ + \u0430\u044E\u0442 \u043E\u0442 \u0441\u0432\u0435\u0442\u043E\u0448\u0443\u043C\ + \u043E\u0432\u044B\u0445 \u0433\u0440\u0430\u043D\u0430\u0442, \u0432 \u043E\ + \u043F\u0440\u0435\u0434\u0435\u043B\u0451\u043D\u043D\u043E\u043C \u0440\u0430\ + \u0434\u0438\u0443\u0441\u0435." + type: Tweak + - message: "\u0421\u0442\u0430\u043D \u043E\u0442 \u0441\u0432\u0435\u0442\u043E\ + \u0448\u0443\u043C\u043E\u0432\u044B\u0445 \u0433\u0440\u0430\u043D\u0430\u0442\ + \ \u0442\u0435\u043F\u0435\u0440\u044C \u0441\u043A\u0435\u0439\u043B\u0438\u0442\ + \u0441\u044F \u043E\u0442 \u0440\u0430\u0441\u0441\u0442\u043E\u044F\u043D\u0438\ + \u044F." + type: Tweak + - message: "\u0413\u043E\u043B\u043E\u0432\u0430 \u0443\u043B\u044C\u044F \u0442\ + \u0435\u043F\u0435\u0440\u044C \u0447\u0430\u0441\u0442\u0438\u0447\u043D\u043E\ + \ \u0437\u0430\u0449\u0438\u0449\u0430\u0435\u0442 \u043E\u0442 \u0441\u0432\ + \u0435\u0442\u043E\u0448\u0443\u043C\u043E\u0432\u044B\u0445 \u0433\u0440\u0430\ + \u043D\u0430\u0442." + type: Add + id: 409 + time: '2024-07-22T17:06:02.0000000+00:00' + url: https://api.github.com/repos/frosty-dev/ss14-core/pulls/478 From 7c45bd471b6520d3d87701f97fa0c60bd91f004e Mon Sep 17 00:00:00 2001 From: PointPNG <120334454+PointPNG@users.noreply.github.com> Date: Tue, 23 Jul 2024 05:03:31 +0300 Subject: [PATCH 3/6] Wonder and WhiteMoose update (#482) --- Resources/Maps/White/WhiteMoose.yml | 23969 +++++++++++++++++--------- Resources/Maps/White/WonderBox.yml | 76 +- 2 files changed, 15959 insertions(+), 8086 deletions(-) diff --git a/Resources/Maps/White/WhiteMoose.yml b/Resources/Maps/White/WhiteMoose.yml index 2e02742487..bbf42e2651 100644 --- a/Resources/Maps/White/WhiteMoose.yml +++ b/Resources/Maps/White/WhiteMoose.yml @@ -86,7 +86,7 @@ entities: chunks: 0,0: ind: 0,0 - tiles: GAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAGAAAAAAAFAAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGAAAAAAAFAAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAALwAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACAAAAAAACAAAAAAABQAAAAAAHgAAAAAAHgAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACAAAAAAACAAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAALwAAAAAALwAAAAAAHgAAAAAABQAAAAAABQAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAABQAAAAAAHgAAAAAALwAAAAAALwAAAAAAHgAAAAAABQAAAAAAHgAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAABQAAAAAAHgAAAAAALwAAAAAALwAAAAAALwAAAAAAEgAAAAAALwAAAAAALwAAAAAAHgAAAAAABQAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAAHgAAAAAABQAAAAAAHgAAAAAALwAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAALwAAAAAALwAAAAAAHgAAAAAABQAAAAAAHgAAAAAALwAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAFAAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAFAAAAAAABQAAAAAAHgAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAABQAAAAAAHgAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAA + tiles: GAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAGAAAAAAAFAAAAAAAFAAAAAAAEgAAAAAAFAAAAAAAEgAAAAAAFAAAAAAABQAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGAAAAAAAFAAAAAAAEgAAAAAAFAAAAAAAEgAAAAAAFAAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAEgAAAAAAFAAAAAAAEgAAAAAAFAAAAAAABQAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAACgAAAAAABQAAAAAAEgAAAAAAFAAAAAAAEgAAAAAAFAAAAAAAEgAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAFAAAAAAAEgAAAAAACgAAAAAACgAAAAAAFAAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAAEgAAAAAAFAAAAAAACgAAAAAABQAAAAAABQAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAACgAAAAAACgAAAAAAFAAAAAAAEgAAAAAACgAAAAAABQAAAAAACgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAAEgAAAAAAFAAAAAAAEgAAAAAAFAAAAAAAEgAAAAAAEgAAAAAAAgAAAAAAAgAAAAAACgAAAAAABQAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAACgAAAAAACgAAAAAAFAAAAAAAEgAAAAAACgAAAAAABQAAAAAACgAAAAAAAgAAAAAACgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAADwAAAAAABQAAAAAABQAAAAAAEgAAAAAAFAAAAAAACgAAAAAABQAAAAAACgAAAAAAAgAAAAAACgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAAgAAAAAAAgAAAAAABQAAAAAAFAAAAAAAEgAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAEgAAAAAAFAAAAAAACgAAAAAACgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAFAAAAAAAEgAAAAAAFAAAAAAAEgAAAAAABQAAAAAACgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAA version: 6 1,0: ind: 1,0 @@ -118,7 +118,7 @@ entities: version: 6 -1,0: ind: -1,0 - tiles: FAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAHgAAAAAABQAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAABQAAAAAANgAAAAAANgAAAAAANgAAAAAABQAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAANgAAAAAANgAAAAAANgAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAHgAAAAAABQAAAAAABQAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAABQAAAAAANgAAAAAANgAAAAAANgAAAAAABQAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAACAAAAAAABQAAAAAABQAAAAAABQAAAAAANgAAAAAANgAAAAAANgAAAAAANgAAAAAANgAAAAAABQAAAAAAAAAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAACAAAAAAABQAAAAAABQAAAAAABQAAAAAANgAAAAAANgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAAiwAAAAAAiwAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAANgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAAAAAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAANgAAAAAANgAAAAAABQAAAAAACgAAAAAANgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAAAAAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAANgAAAAAANgAAAAAAAgAAAAAANgAAAAAANgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAAiwAAAAAAiwAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAANgAAAAAANgAAAAAABQAAAAAACgAAAAAANgAAAAAANgAAAAAANgAAAAAANgAAAAAABQAAAAAAAAAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAOAAAAAAAOAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAACgAAAAAANwAAAAAANwAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAACgAAAAAANwAAAAAANwAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAA + tiles: FAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAHgAAAAAABQAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAABQAAAAAANgAAAAAANgAAAAAANgAAAAAABQAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAABQAAAAAABQAAAAAABQAAAAAAEAAAAAAAAgAAAAAAAgAAAAAAEAAAAAAAAgAAAAAANgAAAAAANgAAAAAANgAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAHgAAAAAABQAAAAAABQAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAABQAAAAAANgAAAAAANgAAAAAANgAAAAAABQAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAANgAAAAAANgAAAAAANgAAAAAANgAAAAAANgAAAAAABQAAAAAAAAAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAANgAAAAAANgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAAiwAAAAAAiwAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAANgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAAAAAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAACgAAAAAANgAAAAAANgAAAAAABQAAAAAACgAAAAAANgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAAAAAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAACgAAAAAANgAAAAAANgAAAAAAAgAAAAAANgAAAAAANgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAAiwAAAAAAiwAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAACgAAAAAANgAAAAAANgAAAAAABQAAAAAACgAAAAAANgAAAAAANgAAAAAANgAAAAAANgAAAAAABQAAAAAAAAAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAADwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAOAAAAAAAOAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAAgAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAACgAAAAAANwAAAAAANwAAAAAAFAAAAAAAFAAAAAAABQAAAAAAAgAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAANwAAAAAACgAAAAAANwAAAAAANwAAAAAAFAAAAAAAFAAAAAAABQAAAAAAAgAAAAAA version: 6 -1,-1: ind: -1,-1 @@ -130,7 +130,7 @@ entities: version: 6 -2,-1: ind: -2,-1 - tiles: BQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAABQAAAAAAFgAAAAAAFgAAAAAAFgAAAAAAFgAAAAAAGQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAABQAAAAAAFgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAABQAAAAAAAgAAAAAAAgAAAAAABQAAAAAACwAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAFgAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAgAAAAAAFAAAAAAAFAAAAAAABQAAAAAACwAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAFgAAAAAAFgAAAAAAFgAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAgAAAAAAFAAAAAAAAgAAAAAABQAAAAAAMAAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAAgAAAAAABQAAAAAAMAAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAgAAAAAAFAAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAAGgAAAAAABQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAAgAAAAAABQAAAAAACAAAAAAAGQAAAAAABQAAAAAAGQAAAAAAGQAAAAAABQAAAAAABQAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAAgAAAAAABQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAABQAAAAAAGQAAAAAAGQAAAAAAGgAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAABQAAAAAAFgAAAAAAFgAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAGAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAA + tiles: BQAAAAAAGgAAAAAAGgAAAAAAGgAAAAAAGgAAAAAAGgAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAABQAAAAAACgAAAAAACgAAAAAACgAAAAAACgAAAAAAGgAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAACwAAAAAABQAAAAAACgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAABQAAAAAAAgAAAAAAAgAAAAAABQAAAAAACwAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAgAAAAAAFAAAAAAAFAAAAAAABQAAAAAACwAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAgAAAAAAFAAAAAAAAgAAAAAABQAAAAAAMAAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAAgAAAAAABQAAAAAAMAAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAgAAAAAAFAAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAAGgAAAAAABQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAAgAAAAAABQAAAAAACgAAAAAAGQAAAAAABQAAAAAAGQAAAAAAGQAAAAAABQAAAAAABQAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAAgAAAAAABQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAABQAAAAAAGQAAAAAAGQAAAAAAGgAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAABQAAAAAACgAAAAAACgAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAGAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAA version: 6 -3,0: ind: -3,0 @@ -138,15 +138,15 @@ entities: version: 6 -3,-1: ind: -3,-1 - tiles: FgAAAAAACAAAAAAAFgAAAAAABQAAAAAACAAAAAAACAAAAAAACAAAAAAABQAAAAAAFgAAAAAACAAAAAAAFgAAAAAABQAAAAAAFgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAACAAAAAAACAAAAAAAFgAAAAAABQAAAAAAFgAAAAAACAAAAAAAFgAAAAAABQAAAAAAFgAAAAAACAAAAAAAFgAAAAAABQAAAAAAFgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAFgAAAAAACAAAAAAAFgAAAAAABQAAAAAAFgAAAAAACAAAAAAAFgAAAAAABQAAAAAAFgAAAAAACAAAAAAAFgAAAAAABQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAACAAAAAAACAAAAAAACAAAAAAACAAAAAAACAAAAAAACAAAAAAACAAAAAAACAAAAAAACAAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAEAAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAACAAAAAAACAAAAAAACAAAAAAABQAAAAAACAAAAAAACAAAAAAACAAAAAAABQAAAAAAFgAAAAAACAAAAAAAFgAAAAAABQAAAAAAFgAAAAAAFgAAAAAABQAAAAAAGgAAAAAACAAAAAAACAAAAAAACAAAAAAABQAAAAAACAAAAAAACAAAAAAACAAAAAAABQAAAAAAFgAAAAAACAAAAAAAFgAAAAAABQAAAAAAGQAAAAAAGQAAAAAAFgAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACAAAAAAABQAAAAAABQAAAAAACAAAAAAACAAAAAAACAAAAAAABQAAAAAAFgAAAAAAGQAAAAAAFgAAAAAAGQAAAAAAAQAAAAAAAQAAAAAAAQAAAAAABQAAAAAACAAAAAAACAAAAAAACAAAAAAABQAAAAAACAAAAAAAFgAAAAAACAAAAAAABQAAAAAAFgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAAQAAAAAAAQAAAAAAAQAAAAAABQAAAAAACAAAAAAACAAAAAAAGQAAAAAABQAAAAAAFgAAAAAAFgAAAAAAFgAAAAAABQAAAAAAFgAAAAAAFgAAAAAAFgAAAAAACAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAA + tiles: CgAAAAAAGgAAAAAACgAAAAAABQAAAAAAGgAAAAAAGgAAAAAAGgAAAAAABQAAAAAACgAAAAAAGgAAAAAACgAAAAAABQAAAAAACgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGgAAAAAAGgAAAAAACgAAAAAABQAAAAAACgAAAAAAGgAAAAAACgAAAAAABQAAAAAACgAAAAAAGgAAAAAACgAAAAAABQAAAAAACgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAACgAAAAAAGgAAAAAACgAAAAAABQAAAAAACgAAAAAAGgAAAAAACgAAAAAABQAAAAAACgAAAAAAGgAAAAAACgAAAAAABQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAAGQAAAAAABQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAACAAAAAAACAAAAAAACAAAAAAACAAAAAAACAAAAAAACAAAAAAACAAAAAAACAAAAAAACAAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAEAAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAAGgAAAAAACgAAAAAACgAAAAAABQAAAAAAGgAAAAAAGgAAAAAAGgAAAAAABQAAAAAACgAAAAAAGgAAAAAACgAAAAAABQAAAAAACgAAAAAACgAAAAAABQAAAAAAGgAAAAAAGgAAAAAAGgAAAAAAGgAAAAAABQAAAAAAGgAAAAAAGgAAAAAAGgAAAAAABQAAAAAACgAAAAAAGgAAAAAACgAAAAAABQAAAAAAGQAAAAAAGQAAAAAACgAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGgAAAAAABQAAAAAABQAAAAAAGgAAAAAAGgAAAAAAGgAAAAAABQAAAAAACgAAAAAAGQAAAAAACgAAAAAAGQAAAAAAAQAAAAAAAQAAAAAAAQAAAAAABQAAAAAAGgAAAAAAGgAAAAAAGgAAAAAABQAAAAAAGgAAAAAACgAAAAAAGgAAAAAABQAAAAAACgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAAAQAAAAAAAQAAAAAAAQAAAAAABQAAAAAAGgAAAAAAGgAAAAAAGgAAAAAABQAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAACgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAA version: 6 -4,0: ind: -4,0 - tiles: FAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAKAAAAAAALAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAHgAAAAAAEgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAHgAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAHgAAAAAAEgAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALAAAAAAAKAAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAA + tiles: FAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAKAAAAAAALAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAHgAAAAAAEgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAHgAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAHgAAAAAAEgAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALAAAAAAAKAAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAA version: 6 -4,-1: ind: -4,-1 - tiles: KAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAHgAAAAAAMgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAAMgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACAAAAAAAFAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAFAAAAAAABQAAAAAACgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACAAAAAAAFAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAFAAAAAAABQAAAAAACgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAFAAAAAAABQAAAAAACgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAACgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAA + tiles: KAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAHgAAAAAAMgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAAMgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGgAAAAAAFAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAFAAAAAAABQAAAAAACgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAGgAAAAAAFAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAFAAAAAAABQAAAAAACgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAFAAAAAAABQAAAAAACgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAACgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAAFAAAAAAAAgAAAAAAFAAAAAAAGAAAAAAAGAAAAAAAGAAAAAAA version: 6 -5,0: ind: -5,0 @@ -166,7 +166,7 @@ entities: version: 6 -1,1: ind: -1,1 - tiles: BQAAAAAAOAAAAAAAAgAAAAAAOAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAACgAAAAAAEAAAAAAAEAAAAAAACgAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAEAAAAAAACgAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAACgAAAAAAAgAAAAAAEAAAAAAAAgAAAAAACgAAAAAAAgAAAAAAEAAAAAAACgAAAAAACgAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAACgAAAAAAEAAAAAAAEAAAAAAAEAAAAAAACgAAAAAAEAAAAAAAEAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAANQAAAAAACgAAAAAACgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAHgAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALAAAAAAA + tiles: BQAAAAAAOAAAAAAAAgAAAAAAOAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAAAgAAAAAABQAAAAAABQAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAAEAAAAAAACgAAAAAAEAAAAAAAEAAAAAAACgAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAEAAAAAAACgAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAACgAAAAAAAgAAAAAAEAAAAAAAAgAAAAAACgAAAAAAAgAAAAAAEAAAAAAACgAAAAAACgAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAACgAAAAAAEAAAAAAAEAAAAAAAEAAAAAAACgAAAAAAEAAAAAAAEAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAANQAAAAAACgAAAAAACgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAHgAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAABQAAAAAA version: 6 -1,-2: ind: -1,-2 @@ -178,7 +178,7 @@ entities: version: 6 -2,-2: ind: -2,-2 - tiles: BQAAAAAABAAAAAAABAAAAAAABAAAAAAABAAAAAAABAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAABAAAAAAABAAAAAAABAAAAAAABAAAAAAABAAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAJQAAAAAAJQAAAAAAJQAAAAAAJQAAAAAABAAAAAAABAAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAJQAAAAAAJQAAAAAAJQAAAAAAJQAAAAAABAAAAAAABAAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAiwAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAJQAAAAAAJQAAAAAAIgAAAAAAJQAAAAAABAAAAAAABAAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFgAAAAAAFgAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAEgAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAMgAAAAAAHgAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAEgAAAAAAEgAAAAAAGQAAAAAAFgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAEgAAAAAAEgAAAAAAGQAAAAAAFgAAAAAABQAAAAAAEgAAAAAALwAAAAAALwAAAAAAFAAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAGQAAAAAABQAAAAAABQAAAAAALwAAAAAALwAAAAAAEgAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFgAAAAAAFgAAAAAAGQAAAAAABwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAAFgAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAiwAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAABQAAAAAAEgAAAAAAEgAAAAAALwAAAAAAEgAAAAAAFgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAAAgAAAAAAAgAAAAAABQAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAGQAAAAAAGQAAAAAAFgAAAAAAFgAAAAAAFgAAAAAAFgAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAA + tiles: BQAAAAAABAAAAAAABAAAAAAABAAAAAAABAAAAAAABAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAABAAAAAAABAAAAAAABAAAAAAABAAAAAAABAAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAJQAAAAAAJQAAAAAAJQAAAAAAJQAAAAAABAAAAAAABAAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAJQAAAAAAJQAAAAAAJQAAAAAAJQAAAAAABAAAAAAABAAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAiwAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAJQAAAAAAJQAAAAAAIgAAAAAAJQAAAAAABAAAAAAABAAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFgAAAAAAFgAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAEgAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAMgAAAAAAHgAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAEgAAAAAAEgAAAAAAGQAAAAAACgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAEgAAAAAAEgAAAAAAGQAAAAAACgAAAAAABQAAAAAAEgAAAAAALwAAAAAALwAAAAAAFAAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAGQAAAAAABQAAAAAABQAAAAAALwAAAAAALwAAAAAAEgAAAAAABQAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFgAAAAAAFgAAAAAAGQAAAAAABwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAAFgAAAAAAFAAAAAAAGAAAAAAAFAAAAAAABQAAAAAAiwAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAAgAAAAAABQAAAAAAEgAAAAAAEgAAAAAALwAAAAAAEgAAAAAAFgAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAAAgAAAAAAAgAAAAAABQAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAGQAAAAAAGgAAAAAACgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAA version: 6 -2,-3: ind: -2,-3 @@ -202,19 +202,19 @@ entities: version: 6 0,1: ind: 0,1 - tiles: BQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAALwAAAAAALwAAAAAABQAAAAAALwAAAAAALwAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAALwAAAAAABQAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAABQAAAAAALwAAAAAALwAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAHgAAAAAAHgAAAAAALwAAAAAABQAAAAAALwAAAAAALwAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAALwAAAAAALwAAAAAABQAAAAAALwAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAALwAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAALwAAAAAALwAAAAAALwAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAALwAAAAAALwAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAALwAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAiwAAAAAABQAAAAAALwAAAAAALwAAAAAALwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAABQAAAAAALwAAAAAALwAAAAAALwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAiwAAAAAABQAAAAAALwAAAAAALwAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAAiwAAAAAAiwAAAAAAiwAAAAAABQAAAAAALwAAAAAALwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAABwAAAAAABwAAAAAABQAAAAAABwAAAAAABwAAAAAABwAAAAAABwAAAAAABwAAAAAAEwAAAAAAEwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAABQAAAAAABwAAAAAABwAAAAAABwAAAAAABwAAAAAABwAAAAAABwAAAAAABwAAAAAAEwAAAAAAEwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAABwAAAAAABwAAAAAABwAAAAAABwAAAAAABwAAAAAABwAAAAAABQAAAAAABwAAAAAABwAAAAAABwAAAAAAiwAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + tiles: BQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAAFAAAAAAACgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAACgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAACgAAAAAAAgAAAAAABQAAAAAAFAAAAAAAEgAAAAAACgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAACgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAAEgAAAAAAFAAAAAAACgAAAAAAAgAAAAAAAgAAAAAAAgAAAAAACgAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAACgAAAAAACgAAAAAAAgAAAAAABQAAAAAAFAAAAAAAEgAAAAAACgAAAAAACgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAACgAAAAAAAgAAAAAABQAAAAAAEgAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAEgAAAAAAFAAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAAFAAAAAAAEgAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAiwAAAAAABQAAAAAAFAAAAAAAEgAAAAAALwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAABQAAAAAAEgAAAAAAFAAAAAAALwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAiwAAAAAABQAAAAAAFAAAAAAAEgAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAAiwAAAAAAiwAAAAAAiwAAAAAABQAAAAAAEgAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAACgAAAAAAFAAAAAAACgAAAAAACgAAAAAAEgAAAAAAFAAAAAAACgAAAAAACgAAAAAAEgAAAAAACgAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAACgAAAAAAEgAAAAAAFAAAAAAAEgAAAAAAFAAAAAAAEgAAAAAAFAAAAAAAEgAAAAAAFAAAAAAACgAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAABQAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAABQAAAAAABQAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAAAAAAAAAAAAAAAAA version: 6 0,2: ind: 0,2 - tiles: BQAAAAAABwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABwAAAAAACQAAAAAACQAAAAAABwAAAAAABwAAAAAABQAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAACAAAAAAABwAAAAAABQAAAAAABwAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAiwAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAABQAAAAAABQAAAAAACAAAAAAACAAAAAAACAAAAAAABQAAAAAAKAAAAAAAKAAAAAAALAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + tiles: CgAAAAAAEgAAAAAAEgAAAAAABQAAAAAACgAAAAAAEgAAAAAAEgAAAAAACgAAAAAABQAAAAAAEgAAAAAAEgAAAAAACgAAAAAABQAAAAAAKAAAAAAAAAAAAAAAAAAAAAAABQAAAAAAEgAAAAAABQAAAAAABQAAAAAACgAAAAAAEgAAAAAAEgAAAAAACgAAAAAABQAAAAAABQAAAAAAEgAAAAAABQAAAAAABQAAAAAAKAAAAAAAAAAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAEgAAAAAAEgAAAAAAEgAAAAAACgAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAACgAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAKAAAAAAAKAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAKAAAAAAAKAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAKAAAAAAAKAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAKAAAAAAAKAAAAAAABQAAAAAAFAAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAABQAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALAAAAAAAKAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA version: 6 -4,1: ind: -4,1 - tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAABQAAAAAAEgAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAA + tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAKAAAAAAAKAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAKAAAAAAAKAAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAKAAAAAAAKAAAAAAAFAAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAKAAAAAAAKAAAAAAAFAAAAAAABQAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAABQAAAAAAEgAAAAAAEgAAAAAABQAAAAAAFAAAAAAABQAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAAFAAAAAAAFAAAAAAABQAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAA version: 6 -3,1: ind: -3,1 - tiles: BQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAAEgAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAEgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAEgAAAAAABQAAAAAAEgAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAAEgAAAAAAEgAAAAAABQAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAHgAAAAAAEgAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAEgAAAAAAEgAAAAAAEgAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALQAAAAAALQAAAAAALQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALQAAAAAAKAAAAAAAKAAAAAAA + tiles: BQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAAEgAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAEgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAEgAAAAAABQAAAAAAEgAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAABQAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAHgAAAAAAEgAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAAFAAAAAAAFAAAAAAAFAAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAFAAAAAAAHgAAAAAAHgAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALQAAAAAALQAAAAAALQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALQAAAAAAKAAAAAAAKAAAAAAA version: 6 -2,-4: ind: -2,-4 @@ -250,7 +250,7 @@ entities: version: 6 -3,-2: ind: -3,-2 - tiles: BAAAAAAABQAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABQAAAAAABQAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAABQAAAAAAMgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABQAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABAAAAAAABQAAAAAABAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAMAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABAAAAAAABAAAAAAABAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAMgAAAAAABQAAAAAABAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABQAAAAAAMgAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAFgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABAAAAAAABQAAAAAAMgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAFgAAAAAAGQAAAAAACAAAAAAAGQAAAAAABAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAMgAAAAAABQAAAAAABQAAAAAAGQAAAAAAGQAAAAAACAAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFgAAAAAAGQAAAAAACAAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAABQAAAAAABQAAAAAAFgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAFgAAAAAAFgAAAAAAFgAAAAAABQAAAAAAFgAAAAAACAAAAAAAFgAAAAAABQAAAAAAFgAAAAAAFgAAAAAAGQAAAAAAGQAAAAAA + tiles: BAAAAAAABQAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABQAAAAAABQAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAABQAAAAAAMgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABQAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAAMAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABAAAAAAABQAAAAAABAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAMAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABAAAAAAABAAAAAAABAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAMgAAAAAABQAAAAAABAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABAAAAAAABQAAAAAAMgAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAACgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABAAAAAAABQAAAAAAMgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAACgAAAAAAGQAAAAAACAAAAAAAGQAAAAAABAAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAMgAAAAAABQAAAAAABQAAAAAACgAAAAAAGQAAAAAACAAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAAGQAAAAAACAAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAgAAAAAABQAAAAAABQAAAAAACgAAAAAAGQAAAAAAGQAAAAAAGQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAACgAAAAAACgAAAAAACgAAAAAABQAAAAAACgAAAAAAGgAAAAAACgAAAAAABQAAAAAACgAAAAAAFgAAAAAAGQAAAAAAGQAAAAAA version: 6 -5,-2: ind: -5,-2 @@ -270,7 +270,7 @@ entities: version: 6 -4,2: ind: -4,2 - tiles: AAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + tiles: KAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAiwAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA version: 6 -2,2: ind: -2,2 @@ -278,7 +278,7 @@ entities: version: 6 -1,2: ind: -1,2 - tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAKAAAAAAAKAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAKAAAAAAABQAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAABQAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAABQAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAFAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAFAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAAiwAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAA version: 6 1,-2: ind: 1,-2 @@ -324,6 +324,26 @@ entities: ind: -7,-3 tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAABQAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAiwAAAAAABQAAAAAA version: 6 + -5,1: + ind: -5,1 + tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAALAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAAEgAAAAAAEgAAAAAAHgAAAAAAEgAAAAAAEgAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAEgAAAAAAFAAAAAAAEgAAAAAAEgAAAAAAHgAAAAAAEgAAAAAAEgAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAABQAAAAAAEgAAAAAAEgAAAAAAHgAAAAAAEgAAAAAAEgAAAAAAKAAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAAFAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAEgAAAAAAEgAAAAAAEgAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAAEgAAAAAAEgAAAAAAEgAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAAEgAAAAAABQAAAAAAKAAAAAAAKAAAAAAAiwAAAAAABQAAAAAAEgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAEgAAAAAABQAAAAAAiwAAAAAAKAAAAAAA + version: 6 + -5,2: + ind: -5,2 + tiles: iwAAAAAABQAAAAAAEgAAAAAAEgAAAAAAHgAAAAAAEgAAAAAABQAAAAAAHgAAAAAABQAAAAAAEgAAAAAAHgAAAAAAEgAAAAAAEgAAAAAABQAAAAAAiwAAAAAAKAAAAAAAiwAAAAAABQAAAAAAEgAAAAAAEgAAAAAAHgAAAAAAEgAAAAAABQAAAAAAHgAAAAAABQAAAAAAEgAAAAAAHgAAAAAAEgAAAAAAEgAAAAAABQAAAAAAiwAAAAAAKAAAAAAAiwAAAAAABQAAAAAAEgAAAAAAEgAAAAAAHgAAAAAAEgAAAAAABQAAAAAAHgAAAAAABQAAAAAAEgAAAAAAHgAAAAAAEgAAAAAAEgAAAAAABQAAAAAAiwAAAAAAKAAAAAAAiwAAAAAABQAAAAAAEgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAEgAAAAAABQAAAAAAiwAAAAAAKAAAAAAAKAAAAAAABQAAAAAAEgAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAAEgAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAAHgAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAAiwAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAABQAAAAAABQAAAAAABQAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + version: 6 + -6,2: + ind: -6,2 + tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + version: 6 + -6,1: + ind: -6,1 + tiles: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAA + version: 6 + 0,3: + ind: 0,3 + tiles: AAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAALAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAKAAAAAAAKAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA + version: 6 - type: Broadphase - type: Physics bodyStatus: InAir @@ -349,7218 +369,7465 @@ entities: color: '#B7818651' id: 5 decals: - 5096: -10.009225,-49.980217 + 4899: -10.009225,-49.980217 - node: color: '#FFFFFFFF' id: Basalt1 decals: - 1320: -32.40904,23.329243 - 1332: -4.8611717,20.985579 - 1333: 17.734123,22.009039 - 1335: -2,32 - 1337: 19,-5 - 1340: 14,-21 - 1345: -4,-47 - 1346: -3,-53 - 1351: -1,-41 - 1352: -12,-56 - 1358: -18,-56 - 1361: -60,-45 - 1370: -72,3 - 1371: -36,34 - 1374: -53,13 - 1383: -68,-25 - 1384: -72,-26 + 1287: -32.40904,23.329243 + 1299: -4.8611717,20.985579 + 1300: 17.734123,22.009039 + 1302: 19,-5 + 1305: 14,-21 + 1310: -4,-47 + 1311: -3,-53 + 1316: -1,-41 + 1317: -12,-56 + 1323: -18,-56 + 1326: -60,-45 + 1335: -72,3 + 1336: -36,34 + 1339: -53,13 + 1347: -68,-25 + 1348: -72,-26 + 5162: -60,39 + 5163: -62,34 + 5166: -79,43 + 5285: -1,47 + 5287: 8,50 - node: color: '#FFFFFFFF' id: Basalt2 decals: - 1327: -14.476731,23.345797 + 1294: -14.476731,23.345797 - node: color: '#FFFFFFFF' id: Basalt3 decals: - 1323: -38.017628,25.630959 - 1324: -26.136497,21.34644 - 1325: -23.484678,23.477783 - 1326: -18.471771,23.498528 - 1362: -62,-44 + 1290: -38.017628,25.630959 + 1291: -26.136497,21.34644 + 1292: -23.484678,23.477783 + 1293: -18.471771,23.498528 + 1327: -62,-44 + 5286: 15,43 - node: color: '#FFFFFFFF' id: Basalt5 decals: - 1331: -3.0679789,20.913242 - 1336: 17,22 - 1344: -7,-51 - 1353: -13,-57 - 1360: -59,-44 - 1369: -70,2 - 1372: -39,36 - 1376: -53,8 - 1385: -69,-29 + 1298: -3.0679789,20.913242 + 1301: 17,22 + 1309: -7,-51 + 1318: -13,-57 + 1325: -59,-44 + 1334: -70,2 + 1337: -39,36 + 1341: -53,8 + 1349: -69,-29 + 5164: -61,32 + 5165: -84,26 - node: color: '#FFFFFFFF' id: Basalt6 decals: - 1341: 13,-23 - 1349: 8,-40 + 1306: 13,-23 + 1314: 8,-40 - node: color: '#FFFFFFFF' id: Basalt7 decals: - 1321: -34.887512,23.430832 - 1322: -37.96626,27.801846 - 1334: 10.276437,33.776573 - 1342: 12,-22 - 1343: 0,-49 - 1350: 6,-40 - 1363: -63,-41 - 1364: -66,-27 - 1365: -71,-23 - 1366: -66,-19 - 1367: -73,-15 - 1368: -77,-12 + 1288: -34.887512,23.430832 + 1289: -37.96626,27.801846 + 1307: 12,-22 + 1308: 0,-49 + 1315: 6,-40 + 1328: -63,-41 + 1329: -66,-27 + 1330: -71,-23 + 1331: -66,-19 + 1332: -73,-15 + 1333: -77,-12 + 5288: 6,48 - node: color: '#FFFFFFFF' id: Basalt8 decals: - 1328: -11.307752,23.946156 - 1329: -24.101477,21.391861 - 1347: -1,-52 - 1348: 4,-40 - 1359: -23,-65 - 1377: -54,18 - 1378: -55,8 - 1379: -64,2 + 1295: -11.307752,23.946156 + 1296: -24.101477,21.391861 + 1312: -1,-52 + 1313: 4,-40 + 1324: -23,-65 + 1342: -55,8 + 1343: -64,2 - node: color: '#FFFFFFFF' id: Basalt9 decals: - 1375: -54,10 + 1340: -54,10 - node: cleanable: True color: '#48000063' id: Blasto decals: - 2938: -26,-46 - 2939: -26,-46 - 2940: -26,-46 + 2900: -26,-46 + 2901: -26,-46 + 2902: -26,-46 - node: color: '#FFFFFFFF' id: Bot decals: - 95: -12,1 - 96: -13,1 - 98: -14,1 - 188: -11,1 - 882: -54,-7 - 883: -54,-6 - 884: -54,-5 - 885: -54,-4 + 64: -12,1 + 65: -13,1 + 67: -14,1 + 157: -11,1 + 849: -54,-7 + 850: -54,-6 + 851: -54,-5 + 852: -54,-4 - node: color: '#FFFFFFFF' id: BotLeft decals: - 880: -57,-4 - 881: -57,-5 + 847: -57,-4 + 848: -57,-5 - node: color: '#BC863FCC' id: Box decals: - 1524: 6,-26 - 1525: 7,-26 - 1526: 7,-27 - 1527: 6,-27 + 1488: 6,-26 + 1489: 7,-26 + 1490: 7,-27 + 1491: 6,-27 - node: color: '#334E6DCC' id: BoxGreyscale decals: - 766: -79,0 - 767: -80,-1 - 768: -80,-2 - 769: -78,-3 - 770: -77,-3 - 1235: -65,-33 - 1236: -65,-38 - 1313: -88,-32 - 1314: -88,-38 + 735: -79,0 + 736: -80,-1 + 737: -80,-2 + 738: -78,-3 + 739: -77,-3 + 1202: -65,-33 + 1203: -65,-38 + 1280: -88,-32 + 1281: -88,-38 - node: color: '#3C44AACC' id: BoxGreyscale decals: - 1173: -16,-25 + 1140: -16,-25 - node: color: '#52B4E9CC' id: BoxGreyscale decals: - 1411: -36,-11 - 4076: -27,-10 + 1375: -36,-11 + 3957: -27,-10 - node: color: '#B02E26CC' id: BoxGreyscale decals: - 1172: -18,-23 + 1139: -18,-23 - node: color: '#B3B3B3CC' id: BoxGreyscale decals: - 281: -28,17 - 282: -28,19 - 991: -57,-20 - 992: -57,-21 - 993: -57,-22 - 994: -55,-20 - 995: -55,-22 - 1121: -11,-29 - 1122: -12,-29 - 1123: -13,-29 - 1124: -11,-20 - 1125: -12,-20 - 1126: -13,-20 - 1127: -8,-26 - 1128: -9,-26 - 1129: -8,-23 - 1130: -9,-23 - 1163: -16,-27 - 1164: -17,-27 - 1165: -18,-27 - 1166: -15,-25 - 1167: -15,-24 - 1168: -15,-23 - 1169: -16,-21 - 1170: -17,-21 - 1171: -18,-21 - 3327: 2,-15 - 3328: 0,-16 - 3329: 0,-17 - 3330: -2,-16 - 3331: -2,-17 - 3332: -2,-13 - 3333: -2,-12 - 3334: 0,-12 - 3335: 0,-13 - 4940: 1,-8 - 4941: -1,-8 + 250: -28,17 + 251: -28,19 + 958: -57,-20 + 959: -57,-21 + 960: -57,-22 + 961: -55,-20 + 962: -55,-22 + 1088: -11,-29 + 1089: -12,-29 + 1090: -13,-29 + 1091: -11,-20 + 1092: -12,-20 + 1093: -13,-20 + 1094: -8,-26 + 1095: -9,-26 + 1096: -8,-23 + 1097: -9,-23 + 1130: -16,-27 + 1131: -17,-27 + 1132: -18,-27 + 1133: -15,-25 + 1134: -15,-24 + 1135: -15,-23 + 1136: -16,-21 + 1137: -17,-21 + 1138: -18,-21 + 3289: 2,-15 + 3290: 0,-16 + 3291: 0,-17 + 3292: -2,-16 + 3293: -2,-17 + 3294: -2,-13 + 3295: -2,-12 + 3296: 0,-12 + 3297: 0,-13 + 4743: 1,-8 + 4744: -1,-8 - node: color: '#BC863FCC' id: BoxGreyscale decals: - 1530: 2,-27 + 1494: 2,-27 - node: color: '#DE3A3ACC' id: BoxGreyscale decals: - 1017: -1,-5 + 984: -1,-5 + - node: + color: '#EFB34196' + id: BoxGreyscale + decals: + 4976: -71,36 + 4977: -73,36 + 4978: -75,36 + 4992: -69,33 + 4993: -73,29 + 4994: -77,34 - node: color: '#EFB34199' id: BoxGreyscale decals: - 4066: -31,6 + 3947: -31,6 - node: color: '#F98AFFCC' id: BoxGreyscale decals: - 1558: -21,-41 + 1522: -21,-41 - node: color: '#FFFFFFFF' id: BrickTileDarkCornerNe decals: - 902: -60,-5 - 914: -59,-4 + 869: -60,-5 + 881: -59,-4 - node: color: '#FFFFFFFF' id: BrickTileDarkCornerNw decals: - 903: -63,-5 - 915: -64,-4 + 870: -63,-5 + 882: -64,-4 - node: color: '#FFFFFFFF' id: BrickTileDarkCornerSe decals: - 904: -60,-8 - 916: -59,-9 + 871: -60,-8 + 883: -59,-9 - node: color: '#FFFFFFFF' id: BrickTileDarkCornerSw decals: - 905: -63,-8 - 4737: -64,-9 + 872: -63,-8 + 4564: -64,-9 - node: color: '#E6E6E6CC' id: BrickTileDarkEndE decals: - 1224: -62,-36 - 1225: -62,-34 + 1191: -62,-36 + 1192: -62,-34 - node: color: '#E6E6E6CC' id: BrickTileDarkEndW decals: - 1226: -66,-34 - 1227: -66,-36 + 1193: -66,-34 + 1194: -66,-36 - node: color: '#FFFFFFFF' id: BrickTileDarkLineE decals: - 912: -60,-6 - 913: -60,-7 - 927: -59,-8 - 4734: -59,-7 - 4735: -59,-6 - 4736: -59,-5 + 879: -60,-6 + 880: -60,-7 + 894: -59,-8 + 4561: -59,-7 + 4562: -59,-6 + 4563: -59,-5 - node: color: '#E6E6E6CC' id: BrickTileDarkLineN decals: - 1214: -65,-34 - 1215: -64,-34 - 1218: -63,-36 - 1219: -64,-36 - 1220: -65,-36 + 1181: -65,-34 + 1182: -64,-34 + 1185: -63,-36 + 1186: -64,-36 + 1187: -65,-36 - node: color: '#FFFFFFFF' id: BrickTileDarkLineN decals: - 910: -62,-5 - 911: -61,-5 - 923: -63,-4 - 924: -62,-4 - 925: -61,-4 - 926: -60,-4 + 877: -62,-5 + 878: -61,-5 + 890: -63,-4 + 891: -62,-4 + 892: -61,-4 + 893: -60,-4 - node: color: '#E6E6E6CC' id: BrickTileDarkLineS decals: - 1216: -65,-36 - 1217: -64,-36 - 1221: -65,-34 - 1222: -64,-34 - 1223: -63,-34 + 1183: -65,-36 + 1184: -64,-36 + 1188: -65,-34 + 1189: -64,-34 + 1190: -63,-34 - node: color: '#FFFFFFFF' id: BrickTileDarkLineS decals: - 906: -62,-8 - 907: -61,-8 - 917: -60,-9 - 918: -61,-9 - 919: -62,-9 - 920: -63,-9 + 873: -62,-8 + 874: -61,-8 + 884: -60,-9 + 885: -61,-9 + 886: -62,-9 + 887: -63,-9 - node: color: '#FFFFFFFF' id: BrickTileDarkLineW decals: - 908: -63,-7 - 909: -63,-6 - 921: -64,-6 - 922: -64,-5 - 4732: -64,-8 - 4733: -64,-7 + 875: -63,-7 + 876: -63,-6 + 888: -64,-6 + 889: -64,-5 + 4559: -64,-8 + 4560: -64,-7 - node: color: '#334E6DCC' id: BrickTileSteelCornerSe decals: - 5076: -6,3 + 4879: -6,3 - node: color: '#334E6DCC' id: BrickTileSteelCornerSw decals: - 5075: -8,3 + 4878: -8,3 - node: color: '#334E6DCC' id: BrickTileSteelLineE decals: - 5077: -6,4 + 4880: -6,4 - node: color: '#FBB2FFFF' id: BrickTileSteelLineS decals: - 71: -18,-47 + 40: -18,-47 - node: color: '#FBB2FFFF' id: BrickTileSteelLineW decals: - 72: -17,-40 + 41: -17,-40 - node: color: '#334E6DCC' id: BrickTileWhiteCornerNe decals: - 5008: -30,15 - 5063: -9,12 - 5078: -6,5 - 5079: -15,12 - - node: - color: '#3EB38896' - id: BrickTileWhiteCornerNe - decals: - 4427: -46,22 + 4811: -30,15 + 4866: -9,12 + 4881: -6,5 + 4882: -15,12 - node: color: '#52B4E9CC' id: BrickTileWhiteCornerNe decals: - 1393: -27,-8 - 4178: -33,-14 - 4363: -42,-7 - 4366: -42,-4 + 1357: -27,-8 + 4051: -33,-14 + 4236: -42,-7 + 4239: -42,-4 - node: color: '#9FED58CC' id: BrickTileWhiteCornerNe decals: - 237: -23,-8 - 1185: -52,-20 - 4520: 16,-4 + 206: -23,-8 + 1152: -52,-20 + 4347: 16,-4 - node: color: '#B3B3B3CC' id: BrickTileWhiteCornerNe decals: - 316: 15,1 - 362: 35,15 - 405: 22,20 - 695: -50,1 - 1115: -10,-20 - 1153: -15,-20 - 3295: -2,-19 - 4934: 1,-8 + 285: 15,1 + 331: 35,15 + 374: 22,20 + 664: -50,1 + 1082: -10,-20 + 1120: -15,-20 + 3257: -2,-19 + 4737: 1,-8 - node: color: '#DE3A3ACC' id: BrickTileWhiteCornerNe decals: - 1016: 1,-4 - 1265: -92,-38 - 3685: 9,18 - 3698: 7,23 - 4923: 3,20 + 983: 1,-4 + 1232: -92,-38 + 3590: 7,23 + 4726: 3,20 + 5315: 1,15 + - node: + color: '#EFB34196' + id: BrickTileWhiteCornerNe + decals: + 4945: -68,36 + 4973: -71,37 + 5000: -71,26 + 5022: -64,26 - node: color: '#EFB34199' id: BrickTileWhiteCornerNe decals: - 3747: -29,11 - 4007: -39,10 + 3634: -29,11 + 3888: -39,10 - node: color: '#F98AFFCC' id: BrickTileWhiteCornerNe decals: - 1194: -64,-37 - 1584: -14,-60 + 1161: -64,-37 + 1548: -14,-60 - node: color: '#334E6DCC' id: BrickTileWhiteCornerNw decals: - 753: -80,0 - 1290: -94,-33 - 5007: -32,15 - 5072: -8,5 - 5088: -18,12 - - node: - color: '#3EB38896' - id: BrickTileWhiteCornerNw - decals: - 4432: -54,22 + 722: -80,0 + 1257: -94,-33 + 4810: -32,15 + 4875: -8,5 + 4891: -18,12 - node: color: '#52B4E9CC' id: BrickTileWhiteCornerNw decals: - 1199: -62,-37 - 1417: -36,-14 - 4364: -44,-7 - 4365: -44,-4 - 4380: -49,-7 - 4505: -1,7 + 1166: -62,-37 + 1381: -36,-14 + 4237: -44,-7 + 4238: -44,-4 + 4253: -49,-7 + 4333: -1,7 - node: color: '#9FED58CC' id: BrickTileWhiteCornerNw decals: - 1257: -90,-37 + 1224: -90,-37 - node: color: '#B3B3B3CC' id: BrickTileWhiteCornerNw decals: - 274: -28,19 - 403: 20,20 - 440: -6,19 - 1118: -13,-20 - 1152: -19,-20 - 3277: -5,-9 - 4933: -1,-8 + 243: -28,19 + 372: 20,20 + 409: -6,19 + 1085: -13,-20 + 1119: -19,-20 + 3239: -5,-9 + 4736: -1,-8 - node: color: '#DE3A3ACC' id: BrickTileWhiteCornerNw decals: - 1011: -1,-4 - 3689: 8,18 - 3696: 4,23 + 978: -1,-4 + 3581: 8,18 + 3588: 4,23 + 5289: 3,15 + 5316: -1,15 + - node: + color: '#EFB34196' + id: BrickTileWhiteCornerNw + decals: + 4944: -78,36 + 4972: -75,37 + 5025: -69,26 - node: color: '#EFB34199' id: BrickTileWhiteCornerNw decals: - 3744: -32,11 - 4001: -48,9 + 3631: -32,11 + 3882: -48,9 - node: color: '#334E6DCC' id: BrickTileWhiteCornerSe decals: - 765: -76,-3 - 5012: -30,13 - 5061: -9,7 - 5080: -15,10 + 734: -76,-3 + 4815: -30,13 + 4864: -9,7 + 4883: -15,10 - node: color: '#52B4E9CC' id: BrickTileWhiteCornerSe decals: - 1450: -42,-5 + 1414: -42,-5 - node: color: '#9FED58CC' id: BrickTileWhiteCornerSe decals: - 215: -15,-3 + 184: -15,-3 - node: color: '#B3B3B3CC' id: BrickTileWhiteCornerSe decals: - 271: -22,17 - 328: 11,-3 - 350: 35,-2 - 441: -1,17 - 600: -29,-37 - 738: -66,-4 - 1143: -15,-29 - 1317: -10,-29 + 240: -22,17 + 297: 11,-3 + 319: 35,-2 + 410: -1,17 + 569: -29,-37 + 707: -66,-4 + 1110: -15,-29 + 1284: -10,-29 - node: color: '#BC863FCC' id: BrickTileWhiteCornerSe decals: - 674: -3,-36 - 1245: -92,-32 + 643: -3,-36 + 1212: -92,-32 - node: color: '#DE3A3ACC' id: BrickTileWhiteCornerSe decals: - 1203: -64,-33 - 3684: 6,14 - 3686: 9,16 - 4501: 6,2 - 4926: 3,17 + 1170: -64,-33 + 4329: 6,2 + 4729: 3,17 + 5310: 1,13 + - node: + color: '#EFB34196' + id: BrickTileWhiteCornerSe + decals: + 5023: -64,24 - node: color: '#EFB34199' id: BrickTileWhiteCornerSe decals: - 3749: -29,10 - 4032: -27,9 - 4039: -34,12 + 3636: -29,10 + 3913: -27,9 + 3920: -34,12 - node: color: '#F98AFFCC' id: BrickTileWhiteCornerSe decals: - 1595: -11,-69 - 1604: -8,-72 + 1559: -11,-69 + 1568: -8,-72 - node: color: '#334E6DCC' id: BrickTileWhiteCornerSw decals: - 754: -80,-3 - 1207: -62,-33 - 1248: -90,-33 - 1289: -94,-37 - 5011: -32,13 - 5058: -13,7 - 5085: -18,9 - - node: - color: '#3EB38896' - id: BrickTileWhiteCornerSw - decals: - 4433: -54,20 + 723: -80,-3 + 1174: -62,-33 + 1215: -90,-33 + 1256: -94,-37 + 4814: -32,13 + 4861: -13,7 + 4888: -18,9 - node: color: '#52B4E9CC' id: BrickTileWhiteCornerSw decals: - 1449: -44,-5 - 4383: -49,-8 - 4509: -1,6 + 1413: -44,-5 + 4256: -49,-8 + 4337: -1,6 - node: color: '#B3B3B3CC' id: BrickTileWhiteCornerSw decals: - 273: -28,17 - 404: 20,18 - 439: -6,17 - 697: -52,-3 - 1090: -13,-29 + 242: -28,17 + 373: 20,18 + 408: -6,17 + 666: -52,-3 + 1057: -13,-29 - node: color: '#DE3A3ACC' id: BrickTileWhiteCornerSw decals: - 1012: -1,-6 - 3683: 8,16 + 979: -1,-6 + 5292: 3,6 + 5309: -1,13 + - node: + color: '#EFB34196' + id: BrickTileWhiteCornerSw + decals: + 5024: -69,24 + 5030: -62,20 - node: color: '#EFB34199' id: BrickTileWhiteCornerSw decals: - 3745: -32,10 - 4038: -38,12 + 3632: -32,10 + 3919: -38,12 - node: color: '#F98AFFCC' id: BrickTileWhiteCornerSw decals: - 569: -22,-39 - 1544: -23,-45 + 538: -22,-39 + 1508: -23,-45 - node: color: '#52B4E9CC' id: BrickTileWhiteEndE decals: - 3733: -42,-16 + 3620: -42,-16 - node: color: '#B3B3B3CC' id: BrickTileWhiteEndE decals: - 783: 9,-1 - 799: 10,-1 + 752: 9,-1 + 768: 10,-1 - node: color: '#DE3A3ACC' id: BrickTileWhiteEndE decals: - 4502: 10,3 + 4330: 10,3 - node: color: '#334E6DCC' id: BrickTileWhiteEndN decals: - 1302: -88,-32 + 1269: -88,-32 - node: color: '#334E6DCC' id: BrickTileWhiteEndS decals: - 1303: -88,-38 + 1270: -88,-38 - node: color: '#52B4E9CC' id: BrickTileWhiteEndS decals: - 1457: -47,-16 + 1421: -47,-16 - node: color: '#52B4E9CC' id: BrickTileWhiteEndW decals: - 1456: -48,-15 - 3732: -44,-16 + 1420: -48,-15 + 3619: -44,-16 - node: color: '#B3B3B3CC' id: BrickTileWhiteEndW decals: - 782: 4,-1 + 751: 4,-1 - node: color: '#334E6DCC' id: BrickTileWhiteInnerNe decals: - 1287: -94,-37 - 1312: -88,-33 - 1645: -10,19 + 1254: -94,-37 + 1279: -88,-33 + 1608: -10,19 - node: color: '#52B4E9CC' id: BrickTileWhiteInnerNe decals: - 169: -27,-4 - 3735: -43,-16 + 138: -27,-4 + 3622: -43,-16 - node: color: '#9FED58CC' id: BrickTileWhiteInnerNe decals: - 236: -24,-8 - 652: -52,-34 + 205: -24,-8 + 621: -52,-34 - node: color: '#B3B3B3CC' id: BrickTileWhiteInnerNe decals: - 292: -24,0 - 309: 15,0 - 369: 34,15 - 386: 22,0 - 497: -23,-34 - 696: -50,0 - 1112: -10,-22 - 3297: -3,-19 + 261: -24,0 + 278: 15,0 + 338: 34,15 + 355: 22,0 + 466: -23,-34 + 665: -50,0 + 1079: -10,-22 + 3259: -3,-19 - node: color: '#BC863FCC' id: BrickTileWhiteInnerNe decals: - 1486: -3,-30 - 1496: -3,-26 - 1503: 4,-25 + 1450: -3,-30 + 1460: -3,-26 + 1467: 4,-25 - node: color: '#DE3A3ACC' id: BrickTileWhiteInnerNe decals: - 121: -3,0 - 197: -3,4 - 210: 1,0 - 818: 4,12 - 3710: 5,7 + 90: -3,0 + 166: -3,4 + 179: 1,0 + 786: 4,12 + - node: + color: '#EFB34196' + id: BrickTileWhiteInnerNe + decals: + 5041: -60,22 - node: color: '#334E6DCC' id: BrickTileWhiteInnerNw decals: - 1286: -91,-37 - 1291: -94,-34 - 5028: -18,19 + 1253: -91,-37 + 1258: -94,-34 + 4831: -18,19 - node: color: '#52B4E9CC' id: BrickTileWhiteInnerNw decals: - 168: -25,-4 - 1392: -29,-9 - 1405: -33,-10 - 1462: -47,-15 - 3734: -43,-16 + 137: -25,-4 + 1356: -29,-9 + 1369: -33,-10 + 1426: -47,-15 + 3621: -43,-16 - node: color: '#9FED58CC' id: BrickTileWhiteInnerNw decals: - 560: -25,-34 - 651: -53,-34 + 529: -25,-34 + 620: -53,-34 - node: color: '#B3B3B3CC' id: BrickTileWhiteInnerNw decals: - 258: -4,0 - 293: -25,0 - 384: 34,0 - 419: 21,0 - 473: -5,-34 - 1106: -10,-28 - 3302: -4,-9 + 227: -4,0 + 262: -25,0 + 353: 34,0 + 388: 21,0 + 442: -5,-34 + 1073: -10,-28 + 3264: -4,-9 - node: color: '#BC863FCC' id: BrickTileWhiteInnerNw decals: - 1487: -1,-30 - 1501: 3,-26 + 1451: -1,-30 + 1465: 3,-26 - node: color: '#DE3A3ACC' id: BrickTileWhiteInnerNw decals: - 123: -1,0 - 4511: 5,15 + 92: -1,0 + 4339: 5,15 + 5307: 3,11 - node: color: '#334E6DCC' id: BrickTileWhiteInnerSe decals: - 1285: -94,-33 - 1305: -88,-37 - 5084: -17,10 + 1252: -94,-33 + 1272: -88,-37 + 4887: -17,10 - node: color: '#52B4E9CC' id: BrickTileWhiteInnerSe decals: - 167: -27,-2 + 136: -27,-2 - node: color: '#9FED58CC' id: BrickTileWhiteInnerSe decals: - 216: -15,-2 - 233: -24,-2 + 185: -15,-2 + 202: -24,-2 - node: color: '#B3B3B3CC' id: BrickTileWhiteInnerSe decals: - 286: -24,17 - 436: 11,-2 - 437: -3,17 - 590: -29,-36 - 737: -66,-2 - 1108: -10,-27 + 255: -24,17 + 405: 11,-2 + 406: -3,17 + 559: -29,-36 + 706: -66,-2 + 1075: -10,-27 - node: color: '#BC863FCC' id: BrickTileWhiteInnerSe decals: - 1485: -3,-27 - 1497: -3,-31 + 1449: -3,-27 + 1461: -3,-31 - node: color: '#DE3A3ACC' id: BrickTileWhiteInnerSe decals: - 135: -3,2 - 268: -3,-2 - 813: 6,6 - 817: 4,14 + 104: -3,2 + 237: -3,-2 + 782: 6,6 + 785: 4,14 - node: color: '#F98AFFCC' id: BrickTileWhiteInnerSe decals: - 581: -17,-36 - 4962: -11,-68 + 550: -17,-36 + 4765: -11,-68 - node: color: '#334E6DCC' id: BrickTileWhiteInnerSw decals: - 1284: -91,-33 - 1292: -94,-36 + 1251: -91,-33 + 1259: -94,-36 - node: color: '#52B4E9CC' id: BrickTileWhiteInnerSw decals: - 510: -25,-2 - 513: -25,-6 - 527: -29,-2 - 1399: -31,-12 - 1461: -47,-15 + 479: -25,-2 + 482: -25,-6 + 496: -29,-2 + 1363: -31,-12 + 1425: -47,-15 - node: color: '#9FED58CC' id: BrickTileWhiteInnerSw decals: - 3674: -16,-2 + 3571: -16,-2 - node: color: '#B3B3B3CC' id: BrickTileWhiteInnerSw decals: - 285: -25,17 - 407: 21,18 - 438: -4,17 - 698: -52,-2 - 1107: -10,-21 - 3274: -4,-2 + 254: -25,17 + 376: 21,18 + 407: -4,17 + 667: -52,-2 + 1074: -10,-21 + 3236: -4,-2 - node: color: '#BC863FCC' id: BrickTileWhiteInnerSw decals: - 1484: -1,-27 - 4796: -4,-42 + 1448: -1,-27 + 4618: -4,-42 - node: color: '#DE3A3ACC' id: BrickTileWhiteInnerSw decals: - 120: -1,2 - 812: 5,6 + 89: -1,2 + 781: 5,6 + 5308: 3,9 - node: color: '#F98AFFCC' id: BrickTileWhiteInnerSw decals: - 578: -22,-36 + 547: -22,-36 - node: color: '#334E6DCC' id: BrickTileWhiteLineE decals: - 161: -24,13 - 287: -24,16 - 764: -76,-1 - 1274: -90,-35 - 1279: -94,-34 - 1280: -94,-35 - 1281: -94,-36 - 1307: -87,-36 - 1308: -87,-35 - 1309: -87,-34 - 5038: -10,20 - 5062: -9,10 - - node: - color: '#3EB38896' - id: BrickTileWhiteLineE - decals: - 4431: -46,20 + 130: -24,13 + 256: -24,16 + 733: -76,-1 + 1241: -90,-35 + 1246: -94,-34 + 1247: -94,-35 + 1248: -94,-36 + 1274: -87,-36 + 1275: -87,-35 + 1276: -87,-34 + 4841: -10,20 + 4865: -9,10 - node: color: '#52B4E9CC' id: BrickTileWhiteLineE decals: - 164: -27,-3 - 1394: -27,-9 - 1395: -27,-11 - 1414: -27,-16 - 1416: -33,-16 - 1418: -32,-21 - 1419: -33,-18 - 1430: -43,-14 - 1431: -43,-15 - 1441: -38,-11 - 1451: -38,-6 - 1458: -47,-15 - 1459: -47,-14 - 4075: -27,-10 - 4146: -27,-12 - 4180: -33,-15 - 4368: -38,-5 + 133: -27,-3 + 1358: -27,-9 + 1359: -27,-11 + 1378: -27,-16 + 1380: -33,-16 + 1382: -32,-21 + 1383: -33,-18 + 1394: -43,-14 + 1395: -43,-15 + 1405: -38,-11 + 1415: -38,-6 + 1422: -47,-15 + 1423: -47,-14 + 3956: -27,-10 + 4019: -27,-12 + 4053: -33,-15 + 4241: -38,-5 - node: color: '#639137CC' id: BrickTileWhiteLineE decals: - 1188: -64,-38 + 1155: -64,-38 - node: color: '#9FED58CC' id: BrickTileWhiteLineE decals: - 234: -24,-3 - 235: -24,-7 - 238: -23,-9 - 239: -23,-11 - 240: -23,-12 - 241: -23,-13 - 242: -23,-14 - 243: -23,-16 - 244: -23,-17 - 663: -52,-22 - 664: -52,-23 - 665: -52,-24 - 666: -52,-26 - 667: -52,-27 - 668: -52,-28 - 669: -52,-28 - 670: -52,-29 - 671: -52,-30 - 672: -52,-32 - 673: -52,-33 - 4877: 19,15 + 203: -24,-3 + 204: -24,-7 + 207: -23,-9 + 208: -23,-11 + 209: -23,-12 + 210: -23,-13 + 211: -23,-14 + 212: -23,-16 + 213: -23,-17 + 632: -52,-22 + 633: -52,-23 + 634: -52,-24 + 635: -52,-26 + 636: -52,-27 + 637: -52,-28 + 638: -52,-28 + 639: -52,-29 + 640: -52,-30 + 641: -52,-32 + 642: -52,-33 + 4699: 19,15 - node: color: '#B3B3B3CC' id: BrickTileWhiteLineE decals: - 147: -24,3 - 148: -24,4 - 149: -24,6 - 150: -24,5 - 151: -24,7 - 152: -24,8 - 153: -24,9 - 154: -24,10 - 155: -24,11 - 272: -22,18 - 289: -24,2 - 290: -24,1 - 349: 35,-1 - 351: 35,0 - 352: 35,1 - 353: 35,2 - 354: 35,3 - 355: 35,6 - 356: 35,7 - 357: 35,8 - 358: 35,9 - 359: 35,10 - 360: 35,11 - 361: 35,12 - 363: 34,18 - 364: 34,17 - 365: 34,16 - 385: 22,1 - 387: 22,2 - 388: 22,3 - 389: 22,4 - 390: 22,5 - 391: 22,7 - 392: 22,8 - 393: 22,9 - 394: 22,10 - 395: 22,12 - 396: 22,11 - 397: 22,14 - 398: 22,15 - 399: 22,16 - 400: 22,17 - 401: 22,18 - 402: 22,19 - 444: -1,18 - 455: -23,-23 - 456: -23,-22 - 457: -23,-21 - 458: -23,-20 - 459: -23,-19 - 460: -23,-18 - 461: -3,-8 - 488: -23,-33 - 489: -23,-32 - 490: -23,-31 - 491: -23,-30 - 492: -23,-29 - 493: -23,-28 - 494: -23,-28 - 495: -23,-27 - 496: -23,-26 - 739: -66,-3 - 1109: -10,-28 - 1110: -7,-26 - 1111: -7,-23 - 1113: -10,-21 - 1154: -15,-27 - 1155: -15,-26 - 1156: -15,-23 - 1157: -15,-22 - 1161: -15,-25 - 1162: -15,-24 - 3296: -3,-18 - 3325: -3,-10 - 3326: -3,-11 - 4935: 1,-9 + 116: -24,3 + 117: -24,4 + 118: -24,6 + 119: -24,5 + 120: -24,7 + 121: -24,8 + 122: -24,9 + 123: -24,10 + 124: -24,11 + 241: -22,18 + 258: -24,2 + 259: -24,1 + 318: 35,-1 + 320: 35,0 + 321: 35,1 + 322: 35,2 + 323: 35,3 + 324: 35,6 + 325: 35,7 + 326: 35,8 + 327: 35,9 + 328: 35,10 + 329: 35,11 + 330: 35,12 + 332: 34,18 + 333: 34,17 + 334: 34,16 + 354: 22,1 + 356: 22,2 + 357: 22,3 + 358: 22,4 + 359: 22,5 + 360: 22,7 + 361: 22,8 + 362: 22,9 + 363: 22,10 + 364: 22,12 + 365: 22,11 + 366: 22,14 + 367: 22,15 + 368: 22,16 + 369: 22,17 + 370: 22,18 + 371: 22,19 + 413: -1,18 + 424: -23,-23 + 425: -23,-22 + 426: -23,-21 + 427: -23,-20 + 428: -23,-19 + 429: -23,-18 + 430: -3,-8 + 457: -23,-33 + 458: -23,-32 + 459: -23,-31 + 460: -23,-30 + 461: -23,-29 + 462: -23,-28 + 463: -23,-28 + 464: -23,-27 + 465: -23,-26 + 708: -66,-3 + 1076: -10,-28 + 1077: -7,-26 + 1078: -7,-23 + 1080: -10,-21 + 1121: -15,-27 + 1122: -15,-26 + 1123: -15,-23 + 1124: -15,-22 + 1128: -15,-25 + 1129: -15,-24 + 3258: -3,-18 + 3287: -3,-10 + 3288: -3,-11 + 4738: 1,-9 - node: color: '#BC863FCC' id: BrickTileWhiteLineE decals: - 678: -3,-34 - 679: -3,-33 - 680: -2,-32 - 681: -3,-32 - 682: -3,-29 - 683: -3,-28 - 684: -3,-25 - 685: -3,-24 - 686: -3,-23 - 687: -3,-22 - 688: -3,-21 - 1491: 0,-29 - 1492: 0,-28 - 1499: 5,-31 - 1531: 9,-31 - 1532: 9,-32 - 1533: 9,-33 - 1534: 9,-34 - 4793: -3,-43 - 4794: -3,-42 - 4795: -3,-41 - 5001: -3,-44 + 647: -3,-34 + 648: -3,-33 + 649: -2,-32 + 650: -3,-32 + 651: -3,-29 + 652: -3,-28 + 653: -3,-25 + 654: -3,-24 + 655: -3,-23 + 656: -3,-22 + 657: -3,-21 + 1455: 0,-29 + 1456: 0,-28 + 1463: 5,-31 + 1495: 9,-31 + 1496: 9,-32 + 1497: 9,-33 + 1498: 9,-34 + 4615: -3,-43 + 4616: -3,-42 + 4617: -3,-41 + 4804: -3,-44 - node: color: '#DE3A3ACC' id: BrickTileWhiteLineE decals: - 113: -3,12 - 114: -3,8 - 115: -3,7 - 116: 1,1 - 117: -3,1 - 189: -3,6 - 190: -3,9 - 191: -3,10 - 192: -3,11 - 193: -3,13 - 194: -3,14 - 195: -3,15 - 196: -3,5 - 208: 1,3 - 209: -3,16 - 265: -3,-6 - 266: -3,-4 - 267: -3,-3 - 806: 6,16 - 807: 4,13 - 808: 6,5 - 809: 6,4 - 810: 6,3 - 1015: 1,-5 - 1478: 3,3 - 3303: -3,-7 - 3304: -3,-5 - 4393: -27,-20 - 4492: 6,26 - 4497: 6,15 - 4498: 6,18 - 4499: 6,19 - 4925: 3,19 + 82: -3,12 + 83: -3,8 + 84: -3,7 + 85: 1,1 + 86: -3,1 + 158: -3,6 + 159: -3,9 + 160: -3,10 + 161: -3,11 + 162: -3,13 + 163: -3,14 + 164: -3,15 + 165: -3,5 + 177: 1,3 + 178: -3,16 + 234: -3,-6 + 235: -3,-4 + 236: -3,-3 + 775: 6,16 + 776: 4,13 + 777: 6,5 + 778: 6,4 + 779: 6,3 + 982: 1,-5 + 1442: 3,3 + 3265: -3,-7 + 3266: -3,-5 + 4266: -27,-20 + 4320: 6,26 + 4325: 6,15 + 4326: 6,18 + 4327: 6,19 + 4728: 3,19 + - node: + color: '#EFB34196' + id: BrickTileWhiteLineE + decals: + 4935: -68,35 + 4936: -68,32 + 4937: -68,34 + 4991: -68,33 + 5011: -68,30 + 5012: -68,31 + 5038: -60,23 + 5039: -60,24 + 5040: -60,25 + 5067: -46,20 - node: color: '#EFB34199' id: BrickTileWhiteLineE decals: - 4000: -46,4 - 4011: -39,8 - 4012: -34,8 - 4042: -34,13 - 4043: -34,14 - 4057: -34,4 - 4065: -31,6 + 3881: -46,4 + 3892: -39,8 + 3893: -34,8 + 3923: -34,13 + 3924: -34,14 + 3938: -34,4 + 3946: -31,6 - node: color: '#F98AFFCC' id: BrickTileWhiteLineE decals: - 579: -17,-38 - 580: -17,-37 - 1573: -15,-53 - 1597: -8,-67 - 1598: -11,-65 - 1599: -11,-62 - 1603: -8,-70 - 4189: -8,-71 - 4210: -19,-66 + 548: -17,-38 + 549: -17,-37 + 1537: -15,-53 + 1561: -8,-67 + 1562: -11,-65 + 1563: -11,-62 + 1567: -8,-70 + 4062: -8,-71 + 4083: -19,-66 - node: - color: '#FA750099' + color: '#FA7500CC' id: BrickTileWhiteLineE decals: - 4098: -31,-6 + 4932: -31,-6 - node: color: '#FF9821CC' id: BrickTileWhiteLineE decals: - 1210: -64,-32 + 1177: -64,-32 - node: color: '#334E6DCC' id: BrickTileWhiteLineN decals: - 109: -9,0 - 110: -15,0 - 262: -13,0 - 263: -12,0 - 264: -11,0 - 758: -79,0 - 759: -78,0 - 760: -77,0 - 1282: -93,-37 - 1283: -92,-37 - 1310: -87,-33 - 1625: -18,15 - 1626: -17,15 - 1627: -17,15 - 1628: -16,15 - 1629: -12,15 - 1630: -11,15 - 1631: -10,15 - 1632: -14,15 - 1652: -12,5 - 5009: -31,15 - 5064: -12,12 - 5073: -7,5 - 5081: -16,12 - 5082: -17,12 - - node: - color: '#3EB38896' - id: BrickTileWhiteLineN - decals: - 4428: -47,22 - 4429: -48,22 - 4430: -50,22 - 4437: -52,22 - 4438: -53,22 + 78: -9,0 + 79: -15,0 + 231: -13,0 + 232: -12,0 + 233: -11,0 + 727: -79,0 + 728: -78,0 + 729: -77,0 + 1249: -93,-37 + 1250: -92,-37 + 1277: -87,-33 + 1588: -18,15 + 1589: -17,15 + 1590: -17,15 + 1591: -16,15 + 1592: -12,15 + 1593: -11,15 + 1594: -10,15 + 1595: -14,15 + 1615: -12,5 + 4812: -31,15 + 4867: -12,12 + 4876: -7,5 + 4884: -16,12 + 4885: -17,12 - node: color: '#52B4E9CC' id: BrickTileWhiteLineN decals: - 166: -26,-4 - 1390: -32,-9 - 1391: -30,-9 - 1402: -34,-10 - 1403: -35,-10 - 1432: -43,-10 - 1433: -47,-10 - 4104: -40,-10 - 4105: -41,-10 - 4106: -46,-10 - 4107: -45,-10 - 4381: -48,-7 - 4382: -47,-7 - 4506: 0,7 + 135: -26,-4 + 1354: -32,-9 + 1355: -30,-9 + 1366: -34,-10 + 1367: -35,-10 + 1396: -43,-10 + 1397: -47,-10 + 3983: -40,-10 + 3984: -41,-10 + 3985: -46,-10 + 3986: -45,-10 + 4254: -48,-7 + 4255: -47,-7 + 4334: 0,7 - node: color: '#639137CC' id: BrickTileWhiteLineN decals: - 1260: -93,-38 + 1227: -93,-38 - node: color: '#9FED58CC' id: BrickTileWhiteLineN decals: - 554: -32,-34 - 555: -31,-34 - 556: -30,-34 - 557: -28,-34 - 558: -27,-34 - 559: -26,-34 - 643: -48,-34 - 644: -49,-34 - 645: -50,-34 - 646: -51,-34 - 647: -54,-34 - 648: -55,-34 - 649: -56,-34 - 650: -57,-34 - 4521: 15,-4 - 4868: 18,16 + 523: -32,-34 + 524: -31,-34 + 525: -30,-34 + 526: -28,-34 + 527: -27,-34 + 528: -26,-34 + 612: -48,-34 + 613: -49,-34 + 614: -50,-34 + 615: -51,-34 + 616: -54,-34 + 617: -55,-34 + 618: -56,-34 + 619: -57,-34 + 4348: 15,-4 + 4690: 18,16 - node: color: '#B3B3B3CC' id: BrickTileWhiteLineN decals: - 142: -17,0 - 143: -26,0 - 144: -27,0 - 145: -28,0 - 146: -29,0 - 257: -5,0 - 275: -27,19 - 276: -26,19 - 277: -25,19 - 278: -24,19 - 279: -23,19 - 291: -23,0 - 300: -31,0 - 301: -30,0 - 307: 13,1 - 308: 14,1 - 310: 16,0 - 311: 17,0 - 312: 19,0 - 313: 20,0 - 317: 23,0 - 318: 24,0 - 319: 25,0 - 320: 26,0 - 321: 27,0 - 322: 28,0 - 323: 29,0 - 324: 30,0 - 325: 31,0 - 326: 32,0 - 327: 33,0 - 406: 21,20 - 445: -2,19 - 446: -3,19 - 447: -4,19 - 448: -5,19 - 474: -6,-34 - 475: -8,-34 - 476: -9,-34 - 477: -7,-34 - 478: -10,-34 - 479: -11,-34 - 480: -13,-34 - 481: -12,-34 - 482: -17,-34 - 483: -18,-34 - 484: -19,-34 - 485: -20,-34 - 486: -22,-34 - 487: -21,-34 - 614: -33,-34 - 615: -36,-34 - 616: -35,-34 - 617: -37,-34 - 618: -38,-34 - 619: -41,-34 - 620: -42,-34 - 621: -44,-34 - 622: -45,-34 - 623: -46,-34 - 636: -58,-34 - 637: -47,-34 - 699: -52,0 - 700: -53,0 - 701: -57,0 - 702: -56,0 - 703: -58,0 - 704: -60,0 - 705: -59,0 - 706: -61,0 - 707: -62,0 - 708: -62,0 - 709: -63,0 - 710: -64,0 - 711: -65,0 - 712: -67,0 - 713: -69,0 - 714: -70,0 - 715: -71,0 - 716: -73,0 - 717: -72,0 - 784: 5,-1 - 785: 6,-1 - 786: 8,-1 - 794: 7,-1 - 1066: -40,-34 - 1067: -39,-34 - 1070: -60,-34 - 1094: -13,-28 - 1104: -11,-28 - 1105: -12,-28 - 1114: -9,-22 - 1116: -11,-20 - 1117: -12,-20 - 1158: -18,-20 - 1159: -17,-20 - 1160: -16,-20 - 1581: -16,-34 - 1582: -15,-34 - 1583: -14,-34 - 4931: 0,-8 + 111: -17,0 + 112: -26,0 + 113: -27,0 + 114: -28,0 + 115: -29,0 + 226: -5,0 + 244: -27,19 + 245: -26,19 + 246: -25,19 + 247: -24,19 + 248: -23,19 + 260: -23,0 + 269: -31,0 + 270: -30,0 + 276: 13,1 + 277: 14,1 + 279: 16,0 + 280: 17,0 + 281: 19,0 + 282: 20,0 + 286: 23,0 + 287: 24,0 + 288: 25,0 + 289: 26,0 + 290: 27,0 + 291: 28,0 + 292: 29,0 + 293: 30,0 + 294: 31,0 + 295: 32,0 + 296: 33,0 + 375: 21,20 + 414: -2,19 + 415: -3,19 + 416: -4,19 + 417: -5,19 + 443: -6,-34 + 444: -8,-34 + 445: -9,-34 + 446: -7,-34 + 447: -10,-34 + 448: -11,-34 + 449: -13,-34 + 450: -12,-34 + 451: -17,-34 + 452: -18,-34 + 453: -19,-34 + 454: -20,-34 + 455: -22,-34 + 456: -21,-34 + 583: -33,-34 + 584: -36,-34 + 585: -35,-34 + 586: -37,-34 + 587: -38,-34 + 588: -41,-34 + 589: -42,-34 + 590: -44,-34 + 591: -45,-34 + 592: -46,-34 + 605: -58,-34 + 606: -47,-34 + 668: -52,0 + 669: -53,0 + 670: -57,0 + 671: -56,0 + 672: -58,0 + 673: -60,0 + 674: -59,0 + 675: -61,0 + 676: -62,0 + 677: -62,0 + 678: -63,0 + 679: -64,0 + 680: -65,0 + 681: -67,0 + 682: -69,0 + 683: -70,0 + 684: -71,0 + 685: -73,0 + 686: -72,0 + 753: 5,-1 + 754: 6,-1 + 755: 8,-1 + 763: 7,-1 + 1033: -40,-34 + 1034: -39,-34 + 1037: -60,-34 + 1061: -13,-28 + 1071: -11,-28 + 1072: -12,-28 + 1081: -9,-22 + 1083: -11,-20 + 1084: -12,-20 + 1125: -18,-20 + 1126: -17,-20 + 1127: -16,-20 + 1545: -16,-34 + 1546: -15,-34 + 1547: -14,-34 + 4734: 0,-8 - node: color: '#BC863FCC' id: BrickTileWhiteLineN decals: - 1482: -2,-30 - 1493: 0,-26 - 1494: -2,-26 - 1495: -1,-26 - 1504: 5,-25 - 1505: 6,-25 - 1506: 8,-25 - 1521: 9,-25 + 1446: -2,-30 + 1457: 0,-26 + 1458: -2,-26 + 1459: -1,-26 + 1468: 5,-25 + 1469: 6,-25 + 1470: 8,-25 + 1485: 9,-25 - node: color: '#DE3A3ACC' id: BrickTileWhiteLineN decals: - 122: -2,0 - 124: 4,0 - 125: 11,0 - 134: -2,4 - 198: -1,4 - 199: 0,4 - 200: 3,0 - 201: 5,0 - 202: 6,0 - 203: 8,0 - 204: 9,0 - 205: 10,0 - 211: 2,0 - 790: 7,0 - 814: 7,7 - 815: 4,15 - 820: 7,3 - 1468: -28,-19 - 3667: 3,15 - 4504: 9,3 - 4512: 6,7 - 4889: -59,-38 - 4924: 2,20 + 91: -2,0 + 93: 4,0 + 94: 11,0 + 103: -2,4 + 167: -1,4 + 168: 0,4 + 169: 3,0 + 170: 5,0 + 171: 6,0 + 172: 8,0 + 173: 9,0 + 174: 10,0 + 180: 2,0 + 759: 7,0 + 783: 7,7 + 784: 4,15 + 788: 7,3 + 1432: -28,-19 + 4332: 9,3 + 4710: -59,-38 + 4727: 2,20 + 5191: 8,30 + 5192: 7,30 + 5193: 5,30 + 5194: 4,30 + 5195: 3,30 - node: angle: 4.71238898038469 rad color: '#DE3A3ACC' id: BrickTileWhiteLineN decals: - 4890: -57,-41 - 4891: -57,-40 - 4892: -57,-39 + 4711: -57,-41 + 4712: -57,-40 + 4713: -57,-39 + - node: + color: '#EFB34196' + id: BrickTileWhiteLineN + decals: + 4965: -72,30 + 4966: -74,30 + 4967: -74,37 + 4968: -73,37 + 4969: -72,37 + 5001: -72,26 + 5016: -68,26 + 5017: -66,26 + 5018: -65,26 + 5035: -57,22 + 5036: -58,22 + 5037: -59,22 + 5062: -53,22 + 5063: -52,22 + 5068: -48,22 + 5069: -50,22 - node: color: '#EFB34199' id: BrickTileWhiteLineN decals: - 3743: -31,11 - 3748: -30,11 - 3950: -55,0 - 3954: -49,0 - 3955: -48,0 - 3956: -47,0 - 3957: -46,0 - 3958: -45,0 - 3959: -44,0 - 3960: -42,0 - 3961: -41,0 - 3962: -32,0 - 3963: -33,0 - 4002: -47,9 - 4003: -45,9 - 4004: -44,9 - 4005: -43,9 - 4006: -40,10 - 4016: -35,10 + 3630: -31,11 + 3635: -30,11 + 3832: -55,0 + 3836: -49,0 + 3837: -48,0 + 3838: -47,0 + 3839: -46,0 + 3840: -45,0 + 3841: -44,0 + 3842: -42,0 + 3843: -41,0 + 3844: -32,0 + 3845: -33,0 + 3883: -47,9 + 3884: -45,9 + 3885: -44,9 + 3886: -43,9 + 3887: -40,10 + 3897: -35,10 - node: color: '#F98AFFCC' id: BrickTileWhiteLineN decals: - 1555: -16,-45 - 1557: -20,-41 - 1600: -11,-60 + 1519: -16,-45 + 1521: -20,-41 + 1564: -11,-60 - node: color: '#334E6DCC' id: BrickTileWhiteLineS decals: - 761: -78,-3 - 762: -79,-3 - 763: -77,-3 - 928: -54,-2 - 929: -57,-2 - 930: -55,-2 - 931: -58,-2 - 1277: -92,-33 - 1278: -93,-33 - 1306: -87,-37 - 1633: -12,14 - 1634: -14,14 - 1635: -13,14 - 1636: -15,14 - 1637: -16,14 - 1638: -17,14 - 1639: -18,14 - 1640: -12,17 - 1641: -10,17 - 1642: -16,17 - 1643: -14,17 - 1644: -18,17 - 5013: -31,13 - 5018: -9,17 - 5039: -19,17 - 5059: -12,7 - 5060: -10,7 - 5074: -7,3 - 5083: -16,10 - - node: - color: '#3EB38896' - id: BrickTileWhiteLineS - decals: - 4420: -42,20 - 4421: -43,20 - 4435: -52,20 - 4436: -53,20 + 730: -78,-3 + 731: -79,-3 + 732: -77,-3 + 895: -54,-2 + 896: -57,-2 + 897: -55,-2 + 898: -58,-2 + 1244: -92,-33 + 1245: -93,-33 + 1273: -87,-37 + 1596: -12,14 + 1597: -14,14 + 1598: -13,14 + 1599: -15,14 + 1600: -16,14 + 1601: -17,14 + 1602: -18,14 + 1603: -12,17 + 1604: -10,17 + 1605: -16,17 + 1606: -14,17 + 1607: -18,17 + 4816: -31,13 + 4821: -9,17 + 4842: -19,17 + 4862: -12,7 + 4863: -10,7 + 4877: -7,3 + 4886: -16,10 - node: color: '#52B4E9CC' id: BrickTileWhiteLineS decals: - 165: -26,-2 - 172: -26,-6 - 512: -27,-6 - 528: -30,-2 - 529: -31,-2 - 530: -32,-2 - 531: -33,-2 - 532: -34,-2 - 533: -35,-2 - 534: -36,-2 - 535: -38,-2 - 536: -37,-2 - 537: -39,-2 - 538: -40,-2 - 539: -41,-2 - 540: -42,-2 - 541: -43,-2 - 542: -44,-2 - 543: -45,-2 - 1396: -28,-13 - 1397: -29,-13 - 1398: -30,-13 - 1400: -32,-12 - 1401: -33,-12 - 1434: -48,-12 - 1435: -46,-12 - 1436: -45,-12 - 1437: -44,-12 - 1438: -42,-12 - 1439: -41,-12 - 1440: -40,-12 - 1448: -43,-8 - 3731: -43,-16 - 4289: -35,-23 - 4290: -34,-23 - 4291: -32,-23 - 4510: 0,6 + 134: -26,-2 + 141: -26,-6 + 481: -27,-6 + 497: -30,-2 + 498: -31,-2 + 499: -32,-2 + 500: -33,-2 + 501: -34,-2 + 502: -35,-2 + 503: -36,-2 + 504: -38,-2 + 505: -37,-2 + 506: -39,-2 + 507: -40,-2 + 508: -41,-2 + 509: -42,-2 + 510: -43,-2 + 511: -44,-2 + 512: -45,-2 + 1360: -28,-13 + 1361: -29,-13 + 1362: -30,-13 + 1364: -32,-12 + 1365: -33,-12 + 1398: -48,-12 + 1399: -46,-12 + 1400: -45,-12 + 1401: -44,-12 + 1402: -42,-12 + 1403: -41,-12 + 1404: -40,-12 + 1412: -43,-8 + 3618: -43,-16 + 4162: -35,-23 + 4163: -34,-23 + 4164: -32,-23 + 4338: 0,6 - node: color: '#9FED58CC' id: BrickTileWhiteLineS decals: - 212: -12,-2 - 213: -13,-2 - 214: -14,-2 - 226: -18,-2 - 227: -17,-2 - 228: -19,-2 - 229: -20,-2 - 230: -21,-2 - 231: -22,-2 - 232: -23,-2 - 545: -43,-36 - 546: -41,-36 - 547: -40,-36 - 548: -39,-36 - 549: -38,-36 - 550: -37,-36 - 551: -36,-36 - 552: -45,-36 - 553: -46,-36 - 1178: 12,-2 - 1179: 13,-2 - 1180: 17,-2 - 1181: 16,-2 - 1182: 15,-2 - 3675: -11,-2 + 181: -12,-2 + 182: -13,-2 + 183: -14,-2 + 195: -18,-2 + 196: -17,-2 + 197: -19,-2 + 198: -20,-2 + 199: -21,-2 + 200: -22,-2 + 201: -23,-2 + 514: -43,-36 + 515: -41,-36 + 516: -40,-36 + 517: -39,-36 + 518: -38,-36 + 519: -37,-36 + 520: -36,-36 + 521: -45,-36 + 522: -46,-36 + 1145: 12,-2 + 1146: 13,-2 + 1147: 17,-2 + 1148: 16,-2 + 1149: 15,-2 + 3572: -11,-2 - node: color: '#B3B3B3CC' id: BrickTileWhiteLineS decals: - 187: -26,17 - 269: -27,17 - 270: -23,17 - 332: 18,-2 - 333: 19,-2 - 334: 20,-2 - 335: 21,-2 - 336: 22,-2 - 337: 23,-2 - 338: 24,-2 - 339: 25,-2 - 340: 26,-2 - 341: 27,-2 - 342: 28,-2 - 343: 29,-2 - 344: 30,-2 - 345: 31,-2 - 346: 32,-2 - 347: 33,-2 - 348: 34,-2 - 442: -5,17 - 443: -2,17 - 498: -14,-36 - 499: -16,-36 - 589: -35,-36 - 596: -33,-37 - 597: -32,-37 - 598: -31,-37 - 599: -30,-37 - 626: -56,-36 - 627: -55,-36 - 628: -54,-36 - 629: -53,-36 - 630: -52,-36 - 631: -51,-36 - 632: -49,-36 - 633: -48,-36 - 634: -47,-36 - 692: -48,-2 - 693: -50,-2 - 718: -67,-4 - 719: -68,-4 - 720: -69,-4 - 721: -70,-4 - 722: -71,-4 - 723: -72,-4 - 731: -53,-2 - 732: -59,-2 - 733: -61,-2 - 734: -62,-2 - 735: -64,-2 - 736: -65,-2 - 748: -73,-4 - 787: 5,-1 - 788: 6,-1 - 789: 8,-1 - 795: 7,-1 - 1091: -12,-29 - 1092: -11,-29 - 1093: -9,-27 - 1095: -13,-21 - 1096: -12,-21 - 1097: -11,-21 - 1144: -17,-29 - 1145: -16,-29 - 3676: -10,-2 - 3677: -9,-2 - 3678: -7,-2 - 3679: -6,-2 - 3680: -8,-2 - 4477: -5,-2 + 156: -26,17 + 238: -27,17 + 239: -23,17 + 301: 18,-2 + 302: 19,-2 + 303: 20,-2 + 304: 21,-2 + 305: 22,-2 + 306: 23,-2 + 307: 24,-2 + 308: 25,-2 + 309: 26,-2 + 310: 27,-2 + 311: 28,-2 + 312: 29,-2 + 313: 30,-2 + 314: 31,-2 + 315: 32,-2 + 316: 33,-2 + 317: 34,-2 + 411: -5,17 + 412: -2,17 + 467: -14,-36 + 468: -16,-36 + 558: -35,-36 + 565: -33,-37 + 566: -32,-37 + 567: -31,-37 + 568: -30,-37 + 595: -56,-36 + 596: -55,-36 + 597: -54,-36 + 598: -53,-36 + 599: -52,-36 + 600: -51,-36 + 601: -49,-36 + 602: -48,-36 + 603: -47,-36 + 661: -48,-2 + 662: -50,-2 + 687: -67,-4 + 688: -68,-4 + 689: -69,-4 + 690: -70,-4 + 691: -71,-4 + 692: -72,-4 + 700: -53,-2 + 701: -59,-2 + 702: -61,-2 + 703: -62,-2 + 704: -64,-2 + 705: -65,-2 + 717: -73,-4 + 756: 5,-1 + 757: 6,-1 + 758: 8,-1 + 764: 7,-1 + 1058: -12,-29 + 1059: -11,-29 + 1060: -9,-27 + 1062: -13,-21 + 1063: -12,-21 + 1064: -11,-21 + 1111: -17,-29 + 1112: -16,-29 + 3573: -10,-2 + 3574: -9,-2 + 3575: -7,-2 + 3576: -6,-2 + 3577: -8,-2 + 4306: -5,-2 - node: color: '#BC863FCC' id: BrickTileWhiteLineS decals: - 675: -8,-36 - 676: -6,-36 - 677: -4,-36 - 1483: -2,-27 - 1488: -2,-31 - 1489: -1,-31 - 1490: 0,-31 - 1500: 4,-33 - 1507: 6,-28 - 5000: -6,-42 + 644: -8,-36 + 645: -6,-36 + 646: -4,-36 + 1447: -2,-27 + 1452: -2,-31 + 1453: -1,-31 + 1454: 0,-31 + 1464: 4,-33 + 1471: 6,-28 + 4803: -6,-42 - node: color: '#DE3A3ACC' id: BrickTileWhiteLineS decals: - 119: -2,2 - 129: -1,-2 - 130: -2,-2 - 131: 8,-2 - 132: 9,-2 - 252: 1,-2 - 253: 3,-2 - 254: 2,-2 - 255: 6,-2 - 256: 5,-2 - 816: 5,14 - 819: 7,3 - 824: 4,2 - 825: 2,2 - 947: -59,-36 - 948: -57,-36 - 1014: 0,-6 - 1069: -60,-36 - 1469: -28,-22 - 4500: 7,6 - 4503: 9,3 + 88: -2,2 + 98: -1,-2 + 99: -2,-2 + 100: 8,-2 + 101: 9,-2 + 221: 1,-2 + 222: 3,-2 + 223: 2,-2 + 224: 6,-2 + 225: 5,-2 + 787: 7,3 + 791: 4,2 + 792: 2,2 + 914: -59,-36 + 915: -57,-36 + 981: 0,-6 + 1036: -60,-36 + 1433: -28,-22 + 4328: 7,6 + 4331: 9,3 + 5196: 2,29 + 5197: 9,29 + 5203: 5,32 + 5293: 4,6 + 5311: 0,13 + 5328: -58,-42 + - node: + color: '#EFB34196' + id: BrickTileWhiteLineS + decals: + 4946: -71,28 + 4947: -70,28 + 4948: -72,28 + 4949: -74,28 + 4950: -75,28 + 4951: -77,28 + 5019: -68,24 + 5020: -66,24 + 5021: -65,24 + 5031: -61,20 + 5032: -60,20 + 5033: -59,20 + 5034: -58,20 + 5064: -53,20 + 5065: -52,20 + 5070: -42,20 + 5071: -43,20 - node: color: '#EFB34199' id: BrickTileWhiteLineS decals: - 3746: -31,10 - 3750: -30,10 - 3997: -45,11 - 3998: -47,11 - 3999: -47,2 - 4008: -40,7 - 4009: -41,7 - 4010: -46,6 - 4026: -31,9 - 4027: -30,9 - 4028: -29,9 - 4030: -28,9 - 4040: -37,12 - 4041: -35,12 - 4055: -39,3 - 4056: -36,3 + 3633: -31,10 + 3637: -30,10 + 3878: -45,11 + 3879: -47,11 + 3880: -47,2 + 3889: -40,7 + 3890: -41,7 + 3891: -46,6 + 3907: -31,9 + 3908: -30,9 + 3909: -29,9 + 3911: -28,9 + 3921: -37,12 + 3922: -35,12 + 3936: -39,3 + 3937: -36,3 - node: color: '#F98AFFCC' id: BrickTileWhiteLineS decals: - 570: -20,-39 - 571: -19,-39 - 572: -18,-39 - 575: -23,-36 - 576: -24,-36 - 577: -25,-36 - 582: -28,-36 - 1556: -14,-47 - 1560: -27,-44 - 1561: -26,-44 - 1562: -25,-44 - 1593: -15,-69 - 1594: -13,-69 - 1596: -10,-68 + 539: -20,-39 + 540: -19,-39 + 541: -18,-39 + 544: -23,-36 + 545: -24,-36 + 546: -25,-36 + 551: -28,-36 + 1520: -14,-47 + 1524: -27,-44 + 1525: -26,-44 + 1526: -25,-44 + 1557: -15,-69 + 1558: -13,-69 + 1560: -10,-68 - node: color: '#FF9821CC' id: BrickTileWhiteLineS decals: - 1242: -93,-32 + 1209: -93,-32 - node: color: '#334E6DCC' id: BrickTileWhiteLineW decals: - 100: -4,13 - 101: -4,12 - 102: -4,11 - 103: -4,10 - 104: -4,9 - 105: -4,8 - 106: -4,7 - 245: -4,2 - 246: -4,3 - 247: -4,4 - 248: -4,5 - 249: -4,6 - 250: -4,16 - 744: -74,-1 - 745: -74,-3 - 746: -74,0 - 747: -74,-4 - 755: -81,-2 - 756: -80,-2 - 757: -80,-1 - 1068: -60,-35 - 1275: -91,-36 - 1276: -91,-34 - 1304: -88,-37 - 1311: -88,-33 - 1388: -25,13 - 1389: -25,15 - 5010: -32,14 - 5037: -18,20 - 5086: -18,10 - 5087: -18,11 - - node: - color: '#3EB38896' - id: BrickTileWhiteLineW - decals: - 4422: -44,20 - 4434: -54,21 + 69: -4,13 + 70: -4,12 + 71: -4,11 + 72: -4,10 + 73: -4,9 + 74: -4,8 + 75: -4,7 + 214: -4,2 + 215: -4,3 + 216: -4,4 + 217: -4,5 + 218: -4,6 + 219: -4,16 + 713: -74,-1 + 714: -74,-3 + 715: -74,0 + 716: -74,-4 + 724: -81,-2 + 725: -80,-2 + 726: -80,-1 + 1035: -60,-35 + 1242: -91,-36 + 1243: -91,-34 + 1271: -88,-37 + 1278: -88,-33 + 1352: -25,13 + 1353: -25,15 + 4813: -32,14 + 4840: -18,20 + 4889: -18,10 + 4890: -18,11 - node: color: '#52B4E9CC' id: BrickTileWhiteLineW decals: - 162: -29,-3 - 163: -25,-3 - 511: -29,-4 - 514: -25,-7 - 515: -25,-8 - 516: -25,-9 - 517: -25,-10 - 518: -25,-10 - 519: -25,-11 - 520: -25,-12 - 521: -25,-13 - 522: -25,-14 - 523: -25,-14 - 524: -25,-15 - 525: -25,-16 - 526: -25,-17 - 544: -25,-18 - 1251: -90,-32 - 1404: -36,-11 - 1415: -31,-16 - 1428: -43,-14 - 1429: -43,-15 - 1460: -47,-14 - 4369: -40,-6 - 4370: -40,-5 + 131: -29,-3 + 132: -25,-3 + 480: -29,-4 + 483: -25,-7 + 484: -25,-8 + 485: -25,-9 + 486: -25,-10 + 487: -25,-10 + 488: -25,-11 + 489: -25,-12 + 490: -25,-13 + 491: -25,-14 + 492: -25,-14 + 493: -25,-15 + 494: -25,-16 + 495: -25,-17 + 513: -25,-18 + 1218: -90,-32 + 1368: -36,-11 + 1379: -31,-16 + 1392: -43,-14 + 1393: -43,-15 + 1424: -47,-14 + 4242: -40,-6 + 4243: -40,-5 - node: color: '#9FED58CC' id: BrickTileWhiteLineW decals: - 431: 21,12 - 432: 21,13 - 433: 21,14 - 434: 21,15 - 435: 21,17 - 561: -25,-33 - 562: -25,-32 - 563: -25,-31 - 564: -25,-30 - 565: -25,-30 - 566: -25,-28 - 567: -25,-29 - 568: -25,-27 - 653: -53,-33 - 654: -53,-32 - 655: -53,-31 - 656: -53,-29 - 657: -53,-28 - 658: -53,-27 - 659: -53,-25 - 660: -53,-24 - 661: -53,-23 - 984: -53,-22 - 1191: -62,-38 - 4876: 16,14 + 400: 21,12 + 401: 21,13 + 402: 21,14 + 403: 21,15 + 404: 21,17 + 530: -25,-33 + 531: -25,-32 + 532: -25,-31 + 533: -25,-30 + 534: -25,-30 + 535: -25,-28 + 536: -25,-29 + 537: -25,-27 + 622: -53,-33 + 623: -53,-32 + 624: -53,-31 + 625: -53,-29 + 626: -53,-28 + 627: -53,-27 + 628: -53,-25 + 629: -53,-24 + 630: -53,-23 + 951: -53,-22 + 1158: -62,-38 + 4698: 16,14 - node: color: '#B3B3B3CC' id: BrickTileWhiteLineW decals: - 133: -4,1 - 156: -25,8 - 157: -25,12 - 284: -25,16 - 294: -25,2 - 295: -25,1 - 296: -25,4 - 297: -25,3 - 298: -25,5 - 299: -25,6 - 366: 34,16 - 367: 34,17 - 368: 34,18 - 370: 34,15 - 371: 34,14 - 372: 34,12 - 373: 34,11 - 374: 34,10 - 375: 34,9 - 376: 34,9 - 377: 34,8 - 378: 34,7 - 379: 34,5 - 380: 34,4 - 381: 34,3 - 382: 34,2 - 383: 34,1 - 408: 21,11 - 409: 21,9 - 410: 21,10 - 411: 21,8 - 412: 21,7 - 413: 21,6 - 414: 21,5 - 415: 21,4 - 416: 21,3 - 417: 21,2 - 418: 21,1 - 449: -6,18 - 462: -5,-22 - 463: -5,-21 - 464: -5,-23 - 465: -5,-27 - 466: -5,-26 - 467: -5,-28 - 468: -5,-29 - 469: -5,-30 - 470: -5,-31 - 471: -5,-32 - 472: -5,-33 - 502: -25,-24 - 503: -25,-26 - 504: -25,-23 - 1098: -10,-22 - 1099: -10,-23 - 1100: -10,-24 - 1101: -10,-25 - 1102: -10,-26 - 1103: -10,-27 - 1146: -19,-28 - 1147: -19,-27 - 1148: -19,-26 - 1149: -19,-23 - 1150: -19,-22 - 1151: -19,-21 - 3278: -5,-12 - 3279: -5,-13 - 3280: -5,-14 - 3281: -5,-15 - 3282: -5,-16 - 3283: -5,-17 - 3284: -5,-18 - 3285: -5,-19 - 3286: -5,-20 - 3301: -4,-8 - 4478: -4,-3 + 102: -4,1 + 125: -25,8 + 126: -25,12 + 253: -25,16 + 263: -25,2 + 264: -25,1 + 265: -25,4 + 266: -25,3 + 267: -25,5 + 268: -25,6 + 335: 34,16 + 336: 34,17 + 337: 34,18 + 339: 34,15 + 340: 34,14 + 341: 34,12 + 342: 34,11 + 343: 34,10 + 344: 34,9 + 345: 34,9 + 346: 34,8 + 347: 34,7 + 348: 34,5 + 349: 34,4 + 350: 34,3 + 351: 34,2 + 352: 34,1 + 377: 21,11 + 378: 21,9 + 379: 21,10 + 380: 21,8 + 381: 21,7 + 382: 21,6 + 383: 21,5 + 384: 21,4 + 385: 21,3 + 386: 21,2 + 387: 21,1 + 418: -6,18 + 431: -5,-22 + 432: -5,-21 + 433: -5,-23 + 434: -5,-27 + 435: -5,-26 + 436: -5,-28 + 437: -5,-29 + 438: -5,-30 + 439: -5,-31 + 440: -5,-32 + 441: -5,-33 + 471: -25,-24 + 472: -25,-26 + 473: -25,-23 + 1065: -10,-22 + 1066: -10,-23 + 1067: -10,-24 + 1068: -10,-25 + 1069: -10,-26 + 1070: -10,-27 + 1113: -19,-28 + 1114: -19,-27 + 1115: -19,-26 + 1116: -19,-23 + 1117: -19,-22 + 1118: -19,-21 + 3240: -5,-12 + 3241: -5,-13 + 3242: -5,-14 + 3243: -5,-15 + 3244: -5,-16 + 3245: -5,-17 + 3246: -5,-18 + 3247: -5,-19 + 3248: -5,-20 + 3263: -4,-8 + 4307: -4,-3 - node: color: '#BC863FCC' id: BrickTileWhiteLineW decals: - 1213: -62,-32 - 1480: -1,-29 - 1481: -1,-28 - 1498: 2,-32 - 1502: 3,-25 - 1535: 8,-34 - 1536: 8,-33 - 1537: 8,-32 - 1538: 8,-31 - 4792: -4,-43 + 1180: -62,-32 + 1444: -1,-29 + 1445: -1,-28 + 1462: 2,-32 + 1466: 3,-25 + 1499: 8,-34 + 1500: 8,-33 + 1501: 8,-32 + 1502: 8,-31 + 4614: -4,-43 - node: color: '#DE3A3ACC' id: BrickTileWhiteLineW decals: - 118: -1,1 - 505: -25,-21 - 801: 5,3 - 802: 5,5 - 803: 5,16 - 804: 5,17 - 805: 5,19 - 1013: -1,-5 - 1467: -29,-21 - 1472: 3,8 - 1479: 3,3 - 3697: 5,26 - 4927: 1,18 + 87: -1,1 + 474: -25,-21 + 770: 5,3 + 771: 5,5 + 772: 5,16 + 773: 5,17 + 774: 5,19 + 980: -1,-5 + 1431: -29,-21 + 1436: 3,8 + 1443: 3,3 + 3589: 5,26 + 4730: 1,18 + 5204: 4,34 + 5290: 3,13 + 5291: 3,12 + 5317: -1,14 + - node: + color: '#EFB34196' + id: BrickTileWhiteLineW + decals: + 4938: -78,30 + 4939: -78,31 + 4940: -78,33 + 4941: -78,34 + 4942: -78,35 + 4943: -78,32 + 5026: -62,24 + 5027: -62,23 + 5028: -62,22 + 5029: -62,21 + 5066: -54,21 + 5081: -44,20 - node: color: '#EFB34199' id: BrickTileWhiteLineW decals: - 4013: -37,8 - 4033: -25,9 - 4034: -25,11 - 4044: -38,13 - 4045: -38,14 - 4062: -32,6 - 4069: -32,4 + 3894: -37,8 + 3914: -25,9 + 3915: -25,11 + 3925: -38,13 + 3926: -38,14 + 3943: -32,6 + 3950: -32,4 - node: color: '#F98AFFCC' id: BrickTileWhiteLineW decals: - 573: -22,-38 - 574: -22,-37 - 1254: -90,-38 - 1545: -17,-42 - 1546: -17,-42 - 1574: -16,-53 - 1590: -17,-68 - 1591: -17,-67 - 1592: -17,-66 - 1601: -12,-61 - 1602: -12,-62 + 542: -22,-38 + 543: -22,-37 + 1221: -90,-38 + 1509: -17,-42 + 1510: -17,-42 + 1538: -16,-53 + 1554: -17,-68 + 1555: -17,-67 + 1556: -17,-66 + 1565: -12,-61 + 1566: -12,-62 - node: color: '#FFFFFFFF' id: BushAOne decals: - 94: -29.002176,6.899295 + 63: -29.002176,6.899295 - node: color: '#FFFFFFFF' id: BushCThree decals: - 85: -27.200394,5.9990177 - 86: -28.848202,3.4884918 + 54: -27.200394,5.9990177 + 55: -28.848202,3.4884918 - node: color: '#FFFFFFFF' id: BushCTwo decals: - 87: -27.62698,2.287729 - 88: -28.6193,5.793564 - - node: - cleanable: True - color: '#FFFFFFFF' - id: Busha1 - decals: - 27: 9,30 + 56: -27.62698,2.287729 + 57: -28.6193,5.793564 - node: color: '#FFFFFFFF' id: Bushb2 decals: - 92: -27.60913,3.355624 - 93: -28.461962,4.694008 + 61: -27.60913,3.355624 + 62: -28.461962,4.694008 - node: color: '#FFFFFFFF' id: Bushc1 decals: - 89: -27.279594,4.3728065 - 90: -27.939842,6.908904 - 91: -28.978037,2.0424917 - - node: - cleanable: True - color: '#FFFFFFFF' - id: Bushc2 - decals: - 29: 10,30 - 30: 9,29 - - node: - cleanable: True - color: '#FFFFFFFF' - id: Bushf3 - decals: - 28: 10,29 + 58: -27.279594,4.3728065 + 59: -27.939842,6.908904 + 60: -28.978037,2.0424917 - node: cleanable: True angle: 1.5707963267948966 rad color: '#5F00005B' id: Clandestine decals: - 3254: 11,-13 - 3255: 11,-13 - 3256: 11,-13 - 3257: 11,-13 - 3258: 11,-13 + 3216: 11,-13 + 3217: 11,-13 + 3218: 11,-13 + 3219: 11,-13 + 3220: 11,-13 - node: cleanable: True color: '#690000C3' id: Clandestine decals: - 2789: -36,-43 + 2751: -36,-43 - node: cleanable: True color: '#D69949FF' id: ConcreteTrimLineS decals: - 31: 10,-29 + 0: 10,-29 - node: cleanable: True color: '#690000C3' id: Cyber decals: - 2790: -52,-40 + 2752: -52,-40 - node: cleanable: True color: '#00130063' id: Damaged decals: - 2870: -31,-45 - 2871: -31,-41 - 2872: -36,-41 - 2873: -35,-43 - 2874: -33,-53 - 2875: -31,-39 - 2932: -21,-50 - 2933: -22,-50 - 2934: -25,-47 - 2935: -30,-39 - 2936: -31,-39 + 2832: -31,-45 + 2833: -31,-41 + 2834: -36,-41 + 2835: -35,-43 + 2836: -33,-53 + 2837: -31,-39 + 2894: -21,-50 + 2895: -22,-50 + 2896: -25,-47 + 2897: -30,-39 + 2898: -31,-39 - node: cleanable: True color: '#00260063' id: Damaged decals: - 2791: -48,-42 - 2792: -48,-44 - 2793: -51,-48 - 2794: -45,-49 - 2795: -40,-49 - 2796: -40,-52 - 2797: -35,-46 - 2798: -30,-50 - 2799: -31,-49 - 2800: -37,-50 + 2753: -48,-42 + 2754: -48,-44 + 2755: -51,-48 + 2756: -45,-49 + 2757: -40,-49 + 2758: -40,-52 + 2759: -35,-46 + 2760: -30,-50 + 2761: -31,-49 + 2762: -37,-50 - node: cleanable: True color: '#002C005B' id: Damaged decals: - 3249: 9,-23 - 3250: 0,-19 - 3251: 10,-13 - 3252: 11,-13 - 3253: 11,-7 + 3211: 9,-23 + 3212: 0,-19 + 3213: 10,-13 + 3214: 11,-13 + 3215: 11,-7 - node: cleanable: True color: '#00300043' id: Damaged decals: - 2470: -27,-24 - 2471: -31,-26 - 2472: -34,-26 - 2473: -37,-25 - 2474: -38,-20 - 2475: -39,-20 - 2476: -39,-21 - 2477: -39,-22 - 2478: -46,-20 - 2479: -45,-21 + 2432: -27,-24 + 2433: -31,-26 + 2434: -34,-26 + 2435: -37,-25 + 2436: -38,-20 + 2437: -39,-20 + 2438: -39,-21 + 2439: -39,-22 + 2440: -46,-20 + 2441: -45,-21 - node: cleanable: True color: '#004B006B' id: Damaged decals: - 2119: -57,-17 - 2120: -53,-17 - 2121: -53,-13 - 2122: -59,-19 - 2123: -61,-17 - 2124: -59,-27 - 2125: -60,-32 + 2081: -57,-17 + 2082: -53,-17 + 2083: -53,-13 + 2084: -59,-19 + 2085: -61,-17 + 2086: -59,-27 + 2087: -60,-32 - node: color: '#007A006E' id: Damaged decals: - 3501: -21,6 - 3502: -18,3 - 3503: -31,17 - 3504: -35,18 + 3463: -21,6 + 3464: -18,3 + 3465: -31,17 + 3466: -35,18 - node: cleanable: True color: '#134F0BA0' id: Damaged decals: - 3083: 10,-37 + 3045: 10,-37 - node: cleanable: True color: '#484F45A1' id: Damaged decals: - 3082: 8,-38 + 3044: 8,-38 - node: cleanable: True color: '#75EB7F59' id: Damaged decals: - 1982: -65.38233,-5.391706 - 1983: -67,-12 - 1984: -64,-11 - 1985: -57,-9 - 1986: -54,-11 + 1944: -65.38233,-5.391706 + 1945: -67,-12 + 1946: -64,-11 + 1947: -57,-9 + 1948: -54,-11 - node: color: '#BC863FCC' id: Delivery decals: - 1528: 8,-26 - 1529: 8,-27 - 1543: 0,-29 + 1492: 8,-26 + 1493: 8,-27 + 1507: 0,-29 - node: color: '#FFFFFFCC' id: Delivery decals: - 826: -65,-1 - 827: -65,0 - 828: -65,-2 - 829: -53,-2 - 830: -53,-1 - 831: -53,0 - 832: -31,-2 - 833: -31,-1 - 834: -31,0 - 835: -24,1 - 836: -25,1 - 837: -24,16 - 838: -25,16 - 839: -25,-7 - 840: -24,-7 - 841: -23,-1 - 842: -23,-2 - 843: -23,0 - 844: -5,-1 - 845: -5,0 - 846: -3,-3 - 847: 2,-2 - 848: 2,-1 - 849: 2,0 - 850: -3,16 - 851: -4,16 - 852: 20,0 - 853: 20,-1 - 854: 20,-2 - 855: 21,1 - 856: 22,1 - 857: 35,1 - 858: 34,1 - 859: -5,-21 - 860: -4,-21 - 861: -3,-21 - 862: -5,-33 - 863: -4,-33 - 864: -3,-33 - 865: -23,-33 - 866: -24,-33 - 867: -25,-33 - 868: -36,-36 - 869: -36,-35 - 870: -36,-34 - 871: -52,-33 - 872: -53,-33 - 873: -24,-18 - 874: -25,-18 - 875: -23,-18 - 4479: -5,-2 - 4480: -4,-3 - 5040: -21,15 - 5041: -7,14 - 5042: -7,15 - 5051: -21,14 + 793: -65,-1 + 794: -65,0 + 795: -65,-2 + 796: -53,-2 + 797: -53,-1 + 798: -53,0 + 799: -31,-2 + 800: -31,-1 + 801: -31,0 + 802: -24,1 + 803: -25,1 + 804: -24,16 + 805: -25,16 + 806: -25,-7 + 807: -24,-7 + 808: -23,-1 + 809: -23,-2 + 810: -23,0 + 811: -5,-1 + 812: -5,0 + 813: -3,-3 + 814: 2,-2 + 815: 2,-1 + 816: 2,0 + 817: -3,16 + 818: -4,16 + 819: 20,0 + 820: 20,-1 + 821: 20,-2 + 822: 21,1 + 823: 22,1 + 824: 35,1 + 825: 34,1 + 826: -5,-21 + 827: -4,-21 + 828: -3,-21 + 829: -5,-33 + 830: -4,-33 + 831: -3,-33 + 832: -23,-33 + 833: -24,-33 + 834: -25,-33 + 835: -36,-36 + 836: -36,-35 + 837: -36,-34 + 838: -52,-33 + 839: -53,-33 + 840: -24,-18 + 841: -25,-18 + 842: -23,-18 + 4308: -5,-2 + 4309: -4,-3 + 4843: -21,15 + 4844: -7,14 + 4845: -7,15 + 4854: -21,14 + 4979: -67,26 + 4980: -67,25 + 4981: -67,24 + 4982: -70,32 + 4983: -70,33 + 4984: -70,34 + 4985: -76,34 + 4986: -76,33 + 4987: -76,32 + 4988: -76,27 + 4989: -78,27 + 4990: -77,27 - node: color: '#FFFFFFFF' id: Delivery decals: - 97: -10,1 - 206: -3,5 - 207: -4,5 + 66: -10,1 + 175: -3,5 + 176: -4,5 - node: color: '#334E6DCC' id: DeliveryGreyscale decals: - 771: -78,0 - 1239: -66,-35 - 1301: -88,-35 - 1648: -16,19 - 1649: -12,19 - 1650: -13,12 - 4942: -10,5 - 5014: -31,14 - 5015: -28,13 - 5016: -17,17 - 5017: -11,17 - 5108: -11,11 - 5109: -10,11 - 5110: -9,11 - 5111: -9,8 - 5112: -10,8 - 5113: -11,8 - - node: - color: '#3EB38896' - id: DeliveryGreyscale - decals: - 4406: -46,19 - 4407: -47,19 - 4408: -50,19 - 4409: -49,19 - 4410: -51,19 - 4411: -48,19 - 4412: -44,22 - 4413: -43,22 - 4419: -40,20 + 740: -78,0 + 1206: -66,-35 + 1268: -88,-35 + 1611: -16,19 + 1612: -12,19 + 1613: -13,12 + 4745: -10,5 + 4817: -31,14 + 4818: -28,13 + 4819: -17,17 + 4820: -11,17 + 4911: -11,11 + 4912: -10,11 + 4913: -9,11 + 4914: -9,8 + 4915: -10,8 + 4916: -11,8 - node: color: '#52B4E9CC' id: DeliveryGreyscale decals: - 1466: -46,-15 - 3727: -40,-14 - 3728: -40,-15 - 3729: -44,-17 - 3730: -42,-17 - 3739: -49,-11 - 4077: -29,-15 - 4078: -28,-15 - 4079: -27,-17 - 4080: -30,-17 - 4081: -31,-15 - 4100: -31,-13 - 4103: -42,-10 - 4194: -36,-22 - 4377: -46,-7 - 4391: -39,-5 + 1430: -46,-15 + 3614: -40,-14 + 3615: -40,-15 + 3616: -44,-17 + 3617: -42,-17 + 3626: -49,-11 + 3958: -29,-15 + 3959: -28,-15 + 3960: -27,-17 + 3961: -30,-17 + 3962: -31,-15 + 3979: -31,-13 + 3982: -42,-10 + 4067: -36,-22 + 4250: -46,-7 + 4264: -39,-5 - node: color: '#9FED58CC' id: DeliveryGreyscale decals: - 1184: -52,-20 - 4513: 13,-5 - 4869: 16,16 - 4875: 19,13 - 4895: 17,13 - 4896: 16,-6 + 1151: -52,-20 + 4340: 13,-5 + 4691: 16,16 + 4697: 19,13 + 4716: 17,13 + 4717: 16,-6 - node: color: '#B3B3B3CC' id: DeliveryGreyscale decals: - 173: -6,1 - 179: -22,1 - 180: -18,1 - 181: -26,19 - 182: -25,19 - 283: -22,17 - 302: -52,-3 - 303: 11,-3 - 1142: -15,-29 - 1318: -10,-29 - 3588: -21,-14 - 4879: 5,-20 - 4880: 6,-20 + 142: -6,1 + 148: -22,1 + 149: -18,1 + 150: -26,19 + 151: -25,19 + 252: -22,17 + 271: -52,-3 + 272: 11,-3 + 1109: -15,-29 + 1285: -10,-29 + 3550: -21,-14 + 4701: 5,-20 + 4702: 6,-20 - node: color: '#BC863FCC' id: DeliveryGreyscale decals: - 4803: 5,-32 - 4804: 5,-33 - 4814: 4,-24 - 4990: -3,-40 - 4991: -2,-38 - 4992: -3,-38 - 4993: -4,-38 + 4625: 5,-32 + 4626: 5,-33 + 4636: 4,-24 + 4793: -3,-40 + 4794: -2,-38 + 4795: -3,-38 + 4796: -4,-38 + - node: + color: '#DE3A3A96' + id: DeliveryGreyscale + decals: + 4926: 9,15 + 4927: 10,15 + 4928: 11,15 + - node: + angle: 1.5707963267948966 rad + color: '#DE3A3A96' + id: DeliveryGreyscale + decals: + 4922: 11,19 - node: color: '#DE3A3ACC' id: DeliveryGreyscale decals: - 1475: 10,4 - 1476: 9,4 - 3617: 2,12 - 3618: 7,9 - 3619: 3,6 - 3620: 4,6 - 3663: 9,10 - 3706: 2,10 - 3707: 2,9 - 3708: 2,14 - 3709: 2,15 - 3711: -29,-22 - 4482: 8,2 - 4483: 9,2 - 4484: 10,2 - 4485: 9,17 - 4894: -57,-38 - 4897: 10,15 - 4898: 9,15 - 4899: 8,15 - 4900: 8,19 - 4901: 9,19 - 4902: 10,19 - 4917: 1,17 - 4918: 2,17 + 1439: 10,4 + 1440: 9,4 + 3559: 7,9 + 3569: 9,10 + 3598: -29,-22 + 4311: 8,2 + 4312: 9,2 + 4313: 10,2 + 4715: -57,-38 + 4718: 9,19 + 4719: 10,19 + 4720: 1,17 + 4721: 2,17 + 4919: 7,18 + 4920: 7,16 + 5173: 4,33 + 5174: 4,32 + 5175: 4,35 + 5176: 0,32 + 5177: 1,30 + 5178: 1,29 + 5179: 11,32 + 5180: 10,30 + 5181: 10,29 + 5182: 7,29 + 5183: 4,29 + 5295: 2,9 + 5296: 2,11 + 5297: 1,9 + 5298: 0,9 + 5299: -1,9 + 5300: -1,10 + 5301: -1,11 + 5302: 0,11 + 5303: 1,11 + 5323: 5,14 + 5324: 6,14 + 5325: 6,7 + 5326: 5,7 + 5327: -60,-38 + - node: + color: '#EFB34196' + id: DeliveryGreyscale + decals: + 4952: -76,28 + 4953: -78,28 + 5007: -71,24 + 5008: -61,26 + 5009: -62,26 + 5010: -60,26 + 5072: -51,19 + 5073: -50,19 + 5074: -49,19 + 5075: -48,19 + 5076: -47,19 + 5077: -46,19 + 5078: -43,22 + 5079: -44,22 + 5080: -40,20 - node: color: '#EFB34199' id: DeliveryGreyscale decals: - 3870: -44,6 - 3871: -45,6 - 3872: -48,6 - 3873: -48,7 - 3874: -46,5 - 3875: -40,5 - 3889: -42,10 - 3890: -44,13 - 3891: -44,12 - 3892: -44,11 - 3893: -48,12 - 3894: -48,11 - 3897: -37,10 - 3898: -34,10 - 3905: -42,14 - 3906: -42,15 - 3907: -40,15 - 3908: -40,14 - 3914: -44,2 - 3915: -42,2 - 3942: -42,18 - 3943: -40,18 - 3944: -27,11 - 3964: -39,1 - 3965: -40,1 - 3966: -36,1 - 3967: -35,1 - 3968: -34,1 - 4046: -37,15 - 4047: -37,14 - 4048: -36,15 - 4049: -36,14 - 4050: -35,15 - 4051: -35,14 - 4052: -44,4 - 4063: -32,7 - 4064: -31,7 - 4068: -31,4 + 3752: -44,6 + 3753: -45,6 + 3754: -48,6 + 3755: -48,7 + 3756: -46,5 + 3757: -40,5 + 3771: -42,10 + 3772: -44,13 + 3773: -44,12 + 3774: -44,11 + 3775: -48,12 + 3776: -48,11 + 3779: -37,10 + 3780: -34,10 + 3787: -42,14 + 3788: -42,15 + 3789: -40,15 + 3790: -40,14 + 3796: -44,2 + 3797: -42,2 + 3824: -42,18 + 3825: -40,18 + 3826: -27,11 + 3846: -39,1 + 3847: -40,1 + 3848: -36,1 + 3849: -35,1 + 3850: -34,1 + 3927: -37,15 + 3928: -37,14 + 3929: -36,15 + 3930: -36,14 + 3931: -35,15 + 3932: -35,14 + 3933: -44,4 + 3944: -32,7 + 3945: -31,7 + 3949: -31,4 - node: cleanable: True color: '#EFB34199' id: DeliveryGreyscale decals: - 3909: -48,3 - 3910: -48,4 - 3911: -48,5 + 3791: -48,3 + 3792: -48,4 + 3793: -48,5 - node: color: '#F98AFFCC' id: DeliveryGreyscale decals: - 1567: -26,-37 - 1568: -27,-37 - 1577: -17,-53 - 1578: -17,-54 - 1579: -14,-52 - 1580: -14,-53 - 4149: -16,-41 - 4150: -16,-42 - 4151: -16,-43 - 4152: -19,-43 - 4154: -19,-47 - 4155: -20,-47 - 4156: -21,-47 - 4157: -22,-45 - 4158: -17,-47 - 4159: -15,-45 - 4160: -13,-47 - 4161: -12,-45 - 4162: -24,-42 - 4184: -17,-50 - 4185: -14,-50 - 4186: -14,-61 - 4187: -17,-61 - 4188: -17,-60 - 4195: -21,-65 - 4196: -21,-66 - 4197: -13,-69 + 1531: -26,-37 + 1532: -27,-37 + 1541: -17,-53 + 1542: -17,-54 + 1543: -14,-52 + 1544: -14,-53 + 4022: -16,-41 + 4023: -16,-42 + 4024: -16,-43 + 4025: -19,-43 + 4027: -19,-47 + 4028: -20,-47 + 4029: -21,-47 + 4030: -22,-45 + 4031: -17,-47 + 4032: -15,-45 + 4033: -13,-47 + 4034: -12,-45 + 4035: -24,-42 + 4057: -17,-50 + 4058: -14,-50 + 4059: -14,-61 + 4060: -17,-61 + 4061: -17,-60 + 4068: -21,-65 + 4069: -21,-66 + 4070: -13,-69 - node: color: '#FA750096' id: DeliveryGreyscale decals: - 4091: -35,-4 - 4092: -34,-4 - 4093: -34,-7 - 4094: -31,-4 - 4095: -32,-4 - 4128: -34,-6 + 3972: -35,-4 + 3973: -34,-4 + 3974: -34,-7 + 3975: -31,-4 + 3976: -32,-4 + 4005: -34,-6 - node: cleanable: True color: '#690000A8' id: Diablo decals: - 2588: -54,-42 + 2550: -54,-42 - node: color: '#6B0000C0' id: Diablo decals: - 3500: -20,3 + 3462: -20,3 - node: cleanable: True color: '#00130063' id: Dirt decals: - 2927: -27,-46 - 2928: -26,-46 - 2929: -28,-46 - 2930: -28,-47 - 2931: -30,-44 + 2889: -27,-46 + 2890: -26,-46 + 2891: -28,-46 + 2892: -28,-47 + 2893: -30,-44 - node: cleanable: True color: '#484F45A1' id: Dirt decals: - 2976: -9,-43 - 2977: -9,-42 - 2978: -9,-41 - 2979: -9,-40 - 2980: -9,-40 - 2981: -10,-39 - 2982: -13,-39 - 2983: -13,-39 - 2984: -13,-39 - 2985: -14,-39 - 2986: -14,-39 - 2987: -14,-40 - 2988: -14,-42 - 2989: -14,-42 - 2990: -14,-42 - 2991: -14,-41 - 2992: -15,-39 - 2993: -15,-38 - 2994: -9,-48 - 2995: -9,-49 - 2996: -10,-50 - 2997: -10,-49 - 2998: -11,-49 - 2999: -12,-49 - 3000: -12,-49 - 3058: 8,-38 - 3059: 6,-38 - 3060: 8,-37 - 3061: 9,-36 - 3062: 10,-38 - 3063: 7,-38 - 3064: 6,-36 - 3065: 7,-36 - 3066: 4,-36 - 3067: 4,-35 - 3068: 3,-35 - 3069: 2,-36 - 3070: 1,-37 - 3071: 1,-38 - 3072: 1,-39 - 3073: 0,-37 - 3074: 0,-34 - 3075: 0,-33 - 3076: -1,-35 - 3077: -1,-36 - 3078: 0,-36 - 3079: 0,-36 + 2938: -9,-43 + 2939: -9,-42 + 2940: -9,-41 + 2941: -9,-40 + 2942: -9,-40 + 2943: -10,-39 + 2944: -13,-39 + 2945: -13,-39 + 2946: -13,-39 + 2947: -14,-39 + 2948: -14,-39 + 2949: -14,-40 + 2950: -14,-42 + 2951: -14,-42 + 2952: -14,-42 + 2953: -14,-41 + 2954: -15,-39 + 2955: -15,-38 + 2956: -9,-48 + 2957: -9,-49 + 2958: -10,-50 + 2959: -10,-49 + 2960: -11,-49 + 2961: -12,-49 + 2962: -12,-49 + 3020: 8,-38 + 3021: 6,-38 + 3022: 8,-37 + 3023: 9,-36 + 3024: 10,-38 + 3025: 7,-38 + 3026: 6,-36 + 3027: 7,-36 + 3028: 4,-36 + 3029: 4,-35 + 3030: 3,-35 + 3031: 2,-36 + 3032: 1,-37 + 3033: 1,-38 + 3034: 1,-39 + 3035: 0,-37 + 3036: 0,-34 + 3037: 0,-33 + 3038: -1,-35 + 3039: -1,-36 + 3040: 0,-36 + 3041: 0,-36 - node: cleanable: True color: '#4E000063' id: Dirt decals: - 2517: -54,-44 - 2518: -53,-44 - 2519: -53,-45 - 2520: -55,-44 - 2521: -55,-45 - 2522: -55,-43 - 2523: -55,-42 - 2524: -54,-42 - 2525: -54,-42 - 2526: -54,-40 - 2527: -55,-41 - 2528: -55,-40 - 2529: -55,-39 - 2530: -54,-39 - 2531: -54,-39 - 2532: -54,-39 - 2533: -54,-38 - 2534: -54,-38 - 2535: -53,-38 - 2536: -55,-39 - 2537: -53,-38 - 2538: -52,-40 - 2539: -55,-40 - 2540: -51,-41 - 2541: -51,-42 - 2542: -50,-41 - 2543: -50,-40 - 2544: -51,-42 - 2545: -52,-44 - 2546: -52,-44 - 2547: -52,-45 - 2548: -51,-45 - 2549: -52,-44 - 2550: -53,-44 - 2551: -53,-43 + 2479: -54,-44 + 2480: -53,-44 + 2481: -53,-45 + 2482: -55,-44 + 2483: -55,-45 + 2484: -55,-43 + 2485: -55,-42 + 2486: -54,-42 + 2487: -54,-42 + 2488: -54,-40 + 2489: -55,-41 + 2490: -55,-40 + 2491: -55,-39 + 2492: -54,-39 + 2493: -54,-39 + 2494: -54,-39 + 2495: -54,-38 + 2496: -54,-38 + 2497: -53,-38 + 2498: -55,-39 + 2499: -53,-38 + 2500: -52,-40 + 2501: -55,-40 + 2502: -51,-41 + 2503: -51,-42 + 2504: -50,-41 + 2505: -50,-40 + 2506: -51,-42 + 2507: -52,-44 + 2508: -52,-44 + 2509: -52,-45 + 2510: -51,-45 + 2511: -52,-44 + 2512: -53,-44 + 2513: -53,-43 - node: cleanable: True angle: 4.71238898038469 rad color: '#5100007E' id: Dirt decals: - 1995: -56,-9 - 1996: -55,-9 - 1997: -56,-11 - 1998: -54,-9 - 1999: -59,-11 - 2000: -60,-11 - 2001: -61,-11 - 2002: -61,-11 - 2003: -71,-8 - 2004: -72,-8 - 2005: -72,-10 - 2006: -67,-6 - 2007: -66,-7 - 2008: -66,-6 - 2009: -73,-6 - 2010: -75,-7 - 2011: -76,-7 - 2012: -76,-5 - 2013: -75,-6 + 1957: -56,-9 + 1958: -55,-9 + 1959: -56,-11 + 1960: -54,-9 + 1961: -59,-11 + 1962: -60,-11 + 1963: -61,-11 + 1964: -61,-11 + 1965: -71,-8 + 1966: -72,-8 + 1967: -72,-10 + 1968: -67,-6 + 1969: -66,-7 + 1970: -66,-6 + 1971: -73,-6 + 1972: -75,-7 + 1973: -76,-7 + 1974: -76,-5 + 1975: -75,-6 - node: cleanable: True color: '#52000089' id: Dirt decals: - 2043: -61,-14 - 2044: -61,-13 - 2045: -62,-15 - 2046: -61,-17 - 2047: -61,-18 - 2048: -61,-17 - 2049: -58,-17 - 2050: -61,-12 - 2051: -61,-12 - 2052: -58,-11 - 2053: -56,-11 - 2054: -57,-11 - 2055: -56,-9 - 2056: -55,-9 - 2057: -57,-9 - 2058: -56,-9 - 2059: -59,-19 - 2060: -58,-18 - 2061: -53,-18 - 2062: -55,-18 - 2063: -56,-18 - 2064: -56,-18 - 2065: -52,-17 - 2066: -53,-17 - 2067: -53,-17 - 2068: -53,-16 - 2069: -53,-15 - 2070: -54,-15 - 2071: -54,-15 - 2072: -54,-13 - 2073: -53,-13 - 2074: -53,-14 - 2075: -53,-14 - 2105: -59,-31 - 2106: -59,-30 - 2107: -59,-30 - 2108: -59,-29 - 2109: -59,-28 - 2110: -59,-26 - 2111: -59,-24 - 2112: -59,-23 - 2113: -59,-22 - 2114: -59,-20 - 2115: -59,-18 - 2116: -53,-13 - 2117: -53,-15 + 2005: -61,-14 + 2006: -61,-13 + 2007: -62,-15 + 2008: -61,-17 + 2009: -61,-18 + 2010: -61,-17 + 2011: -58,-17 + 2012: -61,-12 + 2013: -61,-12 + 2014: -58,-11 + 2015: -56,-11 + 2016: -57,-11 + 2017: -56,-9 + 2018: -55,-9 + 2019: -57,-9 + 2020: -56,-9 + 2021: -59,-19 + 2022: -58,-18 + 2023: -53,-18 + 2024: -55,-18 + 2025: -56,-18 + 2026: -56,-18 + 2027: -52,-17 + 2028: -53,-17 + 2029: -53,-17 + 2030: -53,-16 + 2031: -53,-15 + 2032: -54,-15 + 2033: -54,-15 + 2034: -54,-13 + 2035: -53,-13 + 2036: -53,-14 + 2037: -53,-14 + 2067: -59,-31 + 2068: -59,-30 + 2069: -59,-30 + 2070: -59,-29 + 2071: -59,-28 + 2072: -59,-26 + 2073: -59,-24 + 2074: -59,-23 + 2075: -59,-22 + 2076: -59,-20 + 2077: -59,-18 + 2078: -53,-13 + 2079: -53,-15 - node: cleanable: True color: '#5600006B' id: Dirt decals: - 2147: -61,-23 - 2148: -62,-23 - 2149: -62,-22 - 2150: -64,-22 - 2151: -61,-20 - 2152: -61,-20 - 2153: -61,-21 - 2154: -63,-21 - 2155: -63,-22 - 2156: -63,-23 + 2109: -61,-23 + 2110: -62,-23 + 2111: -62,-22 + 2112: -64,-22 + 2113: -61,-20 + 2114: -61,-20 + 2115: -61,-21 + 2116: -63,-21 + 2117: -63,-22 + 2118: -63,-23 - node: cleanable: True color: '#6300006D' id: Dirt decals: - 2369: -42,-26 - 2370: -42,-25 - 2371: -41,-25 - 2372: -42,-25 - 2373: -41,-25 - 2374: -41,-26 - 2375: -41,-26 - 2376: -42,-24 - 2377: -41,-26 - 2378: -41,-26 - 2379: -41,-25 - 2380: -41,-24 - 2381: -41,-25 - 2382: -41,-24 - 2383: -41,-25 - 2384: -41,-24 - 2385: -46,-25 - 2386: -46,-26 - 2387: -46,-26 - 2388: -46,-25 - 2389: -46,-25 - 2390: -46,-25 - 2391: -45,-25 - 2392: -46,-24 + 2331: -42,-26 + 2332: -42,-25 + 2333: -41,-25 + 2334: -42,-25 + 2335: -41,-25 + 2336: -41,-26 + 2337: -41,-26 + 2338: -42,-24 + 2339: -41,-26 + 2340: -41,-26 + 2341: -41,-25 + 2342: -41,-24 + 2343: -41,-25 + 2344: -41,-24 + 2345: -41,-25 + 2346: -41,-24 + 2347: -46,-25 + 2348: -46,-26 + 2349: -46,-26 + 2350: -46,-25 + 2351: -46,-25 + 2352: -46,-25 + 2353: -45,-25 + 2354: -46,-24 - node: cleanable: True color: '#630000B6' id: Dirt decals: - 2436: -33,-32 - 2437: -34,-32 - 2438: -36,-32 - 2439: -37,-32 - 2440: -38,-32 - 2441: -37,-31 - 2442: -38,-28 - 2443: -40,-28 - 2444: -41,-28 - 2445: -42,-28 - 2446: -43,-28 - 2447: -43,-28 - 2448: -39,-26 - 2449: -36,-26 - 2450: -36,-25 - 2451: -35,-26 - 2452: -37,-25 - 2453: -30,-26 - 2454: -29,-26 - 2455: -28,-26 - 2456: -27,-25 - 2457: -27,-24 - 2458: -28,-24 - 2459: -29,-24 - 2460: -46,-28 - 2461: -45,-28 - 2462: -42,-28 - 2463: -40,-28 - 2464: -37,-28 - 2465: -37,-29 - 2466: -37,-31 - 2467: -38,-31 - 2468: -38,-32 - 2469: -35,-32 + 2398: -33,-32 + 2399: -34,-32 + 2400: -36,-32 + 2401: -37,-32 + 2402: -38,-32 + 2403: -37,-31 + 2404: -38,-28 + 2405: -40,-28 + 2406: -41,-28 + 2407: -42,-28 + 2408: -43,-28 + 2409: -43,-28 + 2410: -39,-26 + 2411: -36,-26 + 2412: -36,-25 + 2413: -35,-26 + 2414: -37,-25 + 2415: -30,-26 + 2416: -29,-26 + 2417: -28,-26 + 2418: -27,-25 + 2419: -27,-24 + 2420: -28,-24 + 2421: -29,-24 + 2422: -46,-28 + 2423: -45,-28 + 2424: -42,-28 + 2425: -40,-28 + 2426: -37,-28 + 2427: -37,-29 + 2428: -37,-31 + 2429: -38,-31 + 2430: -38,-32 + 2431: -35,-32 - node: cleanable: True color: '#69000063' id: Dirt decals: - 2704: -37,-50 - 2705: -36,-50 - 2706: -35,-49 - 2707: -35,-49 - 2708: -35,-48 - 2709: -35,-48 - 2710: -35,-47 - 2711: -35,-46 - 2712: -36,-49 - 2713: -36,-49 - 2714: -36,-50 - 2715: -38,-50 - 2716: -39,-49 - 2717: -39,-49 - 2718: -40,-50 - 2719: -40,-50 - 2720: -41,-50 - 2721: -42,-49 - 2722: -41,-53 - 2723: -41,-53 - 2724: -42,-53 - 2725: -42,-52 - 2726: -42,-52 - 2727: -40,-52 - 2728: -42,-50 - 2729: -45,-50 - 2730: -45,-50 - 2731: -48,-50 - 2732: -48,-50 - 2733: -48,-50 - 2734: -49,-48 - 2735: -49,-46 - 2736: -49,-45 - 2737: -49,-43 - 2738: -48,-42 - 2739: -48,-41 - 2740: -48,-40 - 2741: -48,-40 - 2742: -48,-39 - 2743: -47,-39 - 2744: -47,-39 - 2745: -47,-40 - 2746: -34,-50 - 2747: -32,-50 - 2748: -30,-49 - 2749: -31,-49 - 2750: -29,-49 - 2751: -30,-50 - 2752: -32,-49 - 2753: -33,-49 + 2666: -37,-50 + 2667: -36,-50 + 2668: -35,-49 + 2669: -35,-49 + 2670: -35,-48 + 2671: -35,-48 + 2672: -35,-47 + 2673: -35,-46 + 2674: -36,-49 + 2675: -36,-49 + 2676: -36,-50 + 2677: -38,-50 + 2678: -39,-49 + 2679: -39,-49 + 2680: -40,-50 + 2681: -40,-50 + 2682: -41,-50 + 2683: -42,-49 + 2684: -41,-53 + 2685: -41,-53 + 2686: -42,-53 + 2687: -42,-52 + 2688: -42,-52 + 2689: -40,-52 + 2690: -42,-50 + 2691: -45,-50 + 2692: -45,-50 + 2693: -48,-50 + 2694: -48,-50 + 2695: -48,-50 + 2696: -49,-48 + 2697: -49,-46 + 2698: -49,-45 + 2699: -49,-43 + 2700: -48,-42 + 2701: -48,-41 + 2702: -48,-40 + 2703: -48,-40 + 2704: -48,-39 + 2705: -47,-39 + 2706: -47,-39 + 2707: -47,-40 + 2708: -34,-50 + 2709: -32,-50 + 2710: -30,-49 + 2711: -31,-49 + 2712: -29,-49 + 2713: -30,-50 + 2714: -32,-49 + 2715: -33,-49 - node: cleanable: True color: '#697D7463' id: Dirt decals: - 2754: -30,-50 - 2755: -29,-50 - 2756: -31,-49 - 2757: -32,-50 - 2758: -33,-50 - 2759: -35,-49 - 2760: -35,-48 - 2761: -35,-47 - 2762: -36,-50 - 2763: -38,-50 - 2764: -40,-50 - 2765: -43,-49 - 2766: -45,-49 - 2767: -46,-50 - 2768: -48,-49 - 2769: -49,-48 - 2770: -49,-48 - 2771: -49,-48 - 2772: -48,-45 - 2773: -47,-44 - 2774: -47,-44 - 2775: -48,-43 - 2776: -48,-43 - 2777: -47,-40 - 2778: -47,-40 - 2779: -48,-39 - 2780: -48,-39 - 2781: -48,-39 - 2782: -47,-38 - 2783: -48,-40 - 2784: -48,-41 - 2785: -48,-42 + 2716: -30,-50 + 2717: -29,-50 + 2718: -31,-49 + 2719: -32,-50 + 2720: -33,-50 + 2721: -35,-49 + 2722: -35,-48 + 2723: -35,-47 + 2724: -36,-50 + 2725: -38,-50 + 2726: -40,-50 + 2727: -43,-49 + 2728: -45,-49 + 2729: -46,-50 + 2730: -48,-49 + 2731: -49,-48 + 2732: -49,-48 + 2733: -49,-48 + 2734: -48,-45 + 2735: -47,-44 + 2736: -47,-44 + 2737: -48,-43 + 2738: -48,-43 + 2739: -47,-40 + 2740: -47,-40 + 2741: -48,-39 + 2742: -48,-39 + 2743: -48,-39 + 2744: -47,-38 + 2745: -48,-40 + 2746: -48,-41 + 2747: -48,-42 - node: cleanable: True color: '#82757C63' id: Dirt decals: - 2810: -33,-54 - 2811: -34,-54 - 2812: -34,-53 - 2813: -33,-53 - 2814: -34,-52 - 2815: -30,-50 - 2816: -32,-47 - 2817: -32,-47 - 2818: -33,-46 - 2819: -31,-47 - 2820: -31,-47 - 2821: -31,-45 - 2822: -32,-45 - 2823: -33,-45 - 2824: -33,-44 - 2825: -33,-44 - 2826: -32,-44 - 2827: -31,-42 - 2828: -31,-41 - 2829: -32,-41 - 2830: -34,-41 - 2831: -34,-41 - 2832: -33,-42 - 2833: -33,-42 - 2834: -33,-42 - 2835: -34,-41 - 2836: -35,-41 - 2837: -35,-42 - 2838: -35,-42 - 2839: -35,-43 - 2840: -36,-43 - 2841: -36,-41 - 2842: -35,-41 - 2843: -36,-42 - 2844: -36,-42 - 2845: -35,-42 + 2772: -33,-54 + 2773: -34,-54 + 2774: -34,-53 + 2775: -33,-53 + 2776: -34,-52 + 2777: -30,-50 + 2778: -32,-47 + 2779: -32,-47 + 2780: -33,-46 + 2781: -31,-47 + 2782: -31,-47 + 2783: -31,-45 + 2784: -32,-45 + 2785: -33,-45 + 2786: -33,-44 + 2787: -33,-44 + 2788: -32,-44 + 2789: -31,-42 + 2790: -31,-41 + 2791: -32,-41 + 2792: -34,-41 + 2793: -34,-41 + 2794: -33,-42 + 2795: -33,-42 + 2796: -33,-42 + 2797: -34,-41 + 2798: -35,-41 + 2799: -35,-42 + 2800: -35,-42 + 2801: -35,-43 + 2802: -36,-43 + 2803: -36,-41 + 2804: -35,-41 + 2805: -36,-42 + 2806: -36,-42 + 2807: -35,-42 - node: color: '#A0A99997' id: Dirt decals: - 3564: -50,3 - 3565: -50,3 - 3566: -50,5 - 3567: -50,6 - 3568: -51,7 - 3569: -51,7 - 3570: -50,9 - 3571: -50,9 - 3572: -52,9 - 3573: -51,10 - 3574: -50,12 - 3575: -51,13 - 3576: -51,13 - 3577: -50,14 - 3578: -50,14 - 3579: -50,15 - 3580: -50,17 - 3581: -48,17 - 3582: -48,17 - 3583: -49,17 - 3584: -46,17 + 3526: -50,3 + 3527: -50,3 + 3528: -50,5 + 3529: -50,6 + 3530: -51,7 + 3531: -51,7 + 3532: -50,9 + 3533: -50,9 + 3534: -52,9 + 3535: -51,10 + 3536: -50,12 + 3537: -51,13 + 3538: -51,13 + 3539: -50,14 + 3540: -50,14 + 3541: -50,15 + 3542: -50,17 + 3543: -48,17 + 3544: -48,17 + 3545: -49,17 + 3546: -46,17 - node: zIndex: 10 color: '#B7818651' id: Dirt decals: - 5097: -53.047485,-9.013238 - 5098: -53.00324,-9.013238 - 5099: -53.00324,-9.013238 - 5100: -53.00324,-9.013238 - 5101: -53.00324,-9.013238 - 5102: -53.00324,-9.013238 + 4900: -53.047485,-9.013238 + 4901: -53.00324,-9.013238 + 4902: -53.00324,-9.013238 + 4903: -53.00324,-9.013238 + 4904: -53.00324,-9.013238 + 4905: -53.00324,-9.013238 - node: cleanable: True color: '#C17B7C6D' id: Dirt decals: - 2302: -37,-22 - 2303: -38,-22 - 2304: -38,-21 - 2305: -38,-21 - 2306: -39,-21 - 2307: -39,-22 - 2308: -38,-20 - 2309: -38,-20 - 2310: -39,-19 - 2311: -41,-19 - 2312: -42,-19 - 2313: -42,-19 - 2314: -42,-19 - 2315: -43,-19 - 2316: -43,-20 - 2317: -45,-22 - 2318: -45,-22 - 2319: -45,-20 - 2320: -41,-22 - 2321: -41,-22 - 2322: -41,-22 - 2323: -41,-22 - 2324: -41,-22 - 2325: -42,-22 - 2326: -41,-21 - 2327: -46,-18 - 2328: -46,-18 - 2329: -47,-18 - 2330: -49,-18 - 2331: -49,-18 - 2332: -50,-16 + 2264: -37,-22 + 2265: -38,-22 + 2266: -38,-21 + 2267: -38,-21 + 2268: -39,-21 + 2269: -39,-22 + 2270: -38,-20 + 2271: -38,-20 + 2272: -39,-19 + 2273: -41,-19 + 2274: -42,-19 + 2275: -42,-19 + 2276: -42,-19 + 2277: -43,-19 + 2278: -43,-20 + 2279: -45,-22 + 2280: -45,-22 + 2281: -45,-20 + 2282: -41,-22 + 2283: -41,-22 + 2284: -41,-22 + 2285: -41,-22 + 2286: -41,-22 + 2287: -42,-22 + 2288: -41,-21 + 2289: -46,-18 + 2290: -46,-18 + 2291: -47,-18 + 2292: -49,-18 + 2293: -49,-18 + 2294: -50,-16 - node: cleanable: True color: '#C1B3BD31' id: Dirt decals: - 2284: -29,-25 - 2285: -30,-26 - 2286: -31,-26 - 2287: -31,-26 + 2246: -29,-25 + 2247: -30,-26 + 2248: -31,-26 + 2249: -31,-26 - node: cleanable: True color: '#C1B3BD6F' id: Dirt decals: - 2288: -32,-26 - 2289: -33,-26 - 2290: -34,-26 - 2291: -34,-26 - 2292: -35,-26 - 2293: -35,-26 - 2294: -35,-26 - 2295: -36,-25 - 2296: -37,-25 - 2297: -37,-25 - 2298: -37,-25 - 2299: -37,-25 - 2300: -38,-26 - 2301: -40,-24 + 2250: -32,-26 + 2251: -33,-26 + 2252: -34,-26 + 2253: -34,-26 + 2254: -35,-26 + 2255: -35,-26 + 2256: -35,-26 + 2257: -36,-25 + 2258: -37,-25 + 2259: -37,-25 + 2260: -37,-25 + 2261: -37,-25 + 2262: -38,-26 + 2263: -40,-24 - node: cleanable: True color: '#C1B3BDBF' id: Dirt decals: - 2214: -46,-21 - 2215: -46,-22 - 2216: -45,-22 - 2217: -45,-21 - 2218: -45,-20 - 2219: -46,-20 - 2220: -46,-18 - 2221: -46,-20 - 2280: -27,-25 - 2281: -27,-26 - 2282: -27,-24 - 2283: -28,-26 + 2176: -46,-21 + 2177: -46,-22 + 2178: -45,-22 + 2179: -45,-21 + 2180: -45,-20 + 2181: -46,-20 + 2182: -46,-18 + 2183: -46,-20 + 2242: -27,-25 + 2243: -27,-26 + 2244: -27,-24 + 2245: -28,-26 - node: color: '#FFFFFF37' id: Dirt decals: - 4757: 5,3 - 4758: 6,5 - 4759: 5,5 - 4760: 6,6 - 4761: 7,6 - 4762: 7,7 - 4763: 5,6 - 4764: 4,6 - 4765: 3,8 - 4766: 4,10 - 4767: 3,10 - 4768: 2,11 - 4769: 3,12 - 4770: 3,13 - 4771: 4,14 - 4772: 5,15 - 4773: 6,15 - 4774: 6,15 - 4775: 4,14 - 4776: 3,13 - 4777: 3,12 - 4778: 4,11 - 4779: 3,10 - 4780: 4,12 - 4781: 4,13 - 4782: 3,13 - 4783: 2,13 - 4784: 3,14 - 4785: 6,15 - 4786: 6,17 - 4787: 8,17 - 4788: 8,16 - 4789: 9,17 - 4790: 7,15 - 4791: 8,18 + 4584: 5,3 + 4585: 6,5 + 4586: 5,5 + 4587: 6,6 + 4588: 7,6 + 4589: 7,7 + 4590: 5,6 + 4591: 3,8 + 4592: 4,10 + 4593: 3,10 + 4594: 3,12 + 4595: 3,13 + 4596: 4,14 + 4597: 5,15 + 4598: 6,15 + 4599: 6,15 + 4600: 4,14 + 4601: 3,13 + 4602: 3,12 + 4603: 4,11 + 4604: 3,10 + 4605: 4,12 + 4606: 4,13 + 4607: 3,13 + 4608: 3,14 + 4609: 6,15 + 4610: 6,17 + 4611: 8,17 + 4612: 7,15 + 4613: 8,18 - node: color: '#FFFFFF5B' id: Dirt decals: - 1878: -61,-11 - 1882: -70,-10 - 1883: -70,-9 - 1884: -71,-9 + 1840: -61,-11 + 1844: -70,-10 + 1845: -70,-9 + 1846: -71,-9 - node: cleanable: True color: '#FFFFFF5B' id: Dirt decals: - 1942: -57,-9 - 1943: -55,-9 - 1944: -54,-9 - 1945: -54,-9 - 1946: -54,-10 - 1947: -54,-11 - 1948: -55,-11 - 1949: -56,-10 - 1950: -58,-11 - 1951: -59,-11 - 1952: -60,-11 - 1953: -61,-11 - 1954: -64,-11 - 1955: -64,-12 - 1956: -64,-12 - 1957: -64,-12 - 1958: -63,-12 - 1959: -64,-11 - 1960: -64,-11 - 1961: -64,-11 - 1962: -66,-12 - 1963: -67,-11 - 1964: -66,-7 - 1965: -66,-6 - 1966: -67,-6 - 1967: -67,-6 - 1968: -71,-6 - 1969: -72,-6 - 1970: -74,-6 - 1971: -75,-6 - 1972: -73,-6 - 1973: -73,-6 - 1974: -75,-7 - 1975: -75,-7 - 1976: -75,-7 - 1977: -76,-5 - 1978: -76,-5 - 1979: -54,-10 - 1980: -53,-10 - 1981: -53,-9 + 1904: -57,-9 + 1905: -55,-9 + 1906: -54,-9 + 1907: -54,-9 + 1908: -54,-10 + 1909: -54,-11 + 1910: -55,-11 + 1911: -56,-10 + 1912: -58,-11 + 1913: -59,-11 + 1914: -60,-11 + 1915: -61,-11 + 1916: -64,-11 + 1917: -64,-12 + 1918: -64,-12 + 1919: -64,-12 + 1920: -63,-12 + 1921: -64,-11 + 1922: -64,-11 + 1923: -64,-11 + 1924: -66,-12 + 1925: -67,-11 + 1926: -66,-7 + 1927: -66,-6 + 1928: -67,-6 + 1929: -67,-6 + 1930: -71,-6 + 1931: -72,-6 + 1932: -74,-6 + 1933: -75,-6 + 1934: -73,-6 + 1935: -73,-6 + 1936: -75,-7 + 1937: -75,-7 + 1938: -75,-7 + 1939: -76,-5 + 1940: -76,-5 + 1941: -54,-10 + 1942: -53,-10 + 1943: -53,-9 - node: cleanable: True color: '#FFFFFF5D' id: Dirt decals: - 3210: 10,-13 - 3211: 9,-13 - 3212: 9,-12 - 3213: 9,-12 - 3214: 9,-12 - 3215: 8,-12 - 3216: 7,-12 - 3217: 6,-12 - 3218: 6,-12 - 3219: 6,-12 - 3220: 5,-12 - 3221: 6,-14 - 3222: 6,-15 - 3223: 11,-16 - 3224: 10,-15 - 3225: 10,-15 - 3226: 10,-16 - 3227: 10,-18 - 3228: 10,-20 - 3229: 10,-21 - 3230: 10,-21 - 3231: 10,-23 - 3232: 9,-23 - 3233: 8,-22 - 3234: 9,-22 - 3235: 8,-22 - 3236: 7,-23 - 3237: 5,-22 - 3238: 4,-22 - 3239: 4,-22 - 3240: 1,-19 - 3241: 2,-19 - 3242: 2,-19 - 3243: 11,-7 - 3244: 11,-6 - 3245: 11,-5 - 3246: 11,-5 - 3247: 10,-5 + 3172: 10,-13 + 3173: 9,-13 + 3174: 9,-12 + 3175: 9,-12 + 3176: 9,-12 + 3177: 8,-12 + 3178: 7,-12 + 3179: 6,-12 + 3180: 6,-12 + 3181: 6,-12 + 3182: 5,-12 + 3183: 6,-14 + 3184: 6,-15 + 3185: 11,-16 + 3186: 10,-15 + 3187: 10,-15 + 3188: 10,-16 + 3189: 10,-18 + 3190: 10,-20 + 3191: 10,-21 + 3192: 10,-21 + 3193: 10,-23 + 3194: 9,-23 + 3195: 8,-22 + 3196: 9,-22 + 3197: 8,-22 + 3198: 7,-23 + 3199: 5,-22 + 3200: 4,-22 + 3201: 4,-22 + 3202: 1,-19 + 3203: 2,-19 + 3204: 2,-19 + 3205: 11,-7 + 3206: 11,-6 + 3207: 11,-5 + 3208: 11,-5 + 3209: 10,-5 - node: color: '#FFFFFF75' id: Dirt decals: - 4752: 3,2 - 4753: 3,4 - 4754: 5,4 - 4755: 5,2 - 4756: 6,4 + 4579: 3,2 + 4580: 3,4 + 4581: 5,4 + 4582: 5,2 + 4583: 6,4 - node: cleanable: True color: '#FFFFFF75' id: Dirt decals: - 4751: -4,-39 + 4578: -4,-39 - node: color: '#FFFFFF7C' id: Dirt decals: - 4797: -3,-41 - 4798: -3,-42 - 4799: -4,-42 - 4800: -3,-43 - 4801: -3,-43 - 4802: -4,-43 + 4619: -3,-41 + 4620: -3,-42 + 4621: -4,-42 + 4622: -3,-43 + 4623: -3,-43 + 4624: -4,-43 - node: color: '#FFFFFFFF' id: Dirt decals: - 3350: -1,22 - 3351: 0,23 - 3596: -20,3 + 3312: -1,22 + 3313: 0,23 + 3558: -20,3 - node: cleanable: True color: '#FFFFFFFF' id: Dirt decals: - 0: 7,31 - 1: 8,31 - 2: 9,31 - 3: 5,29 - 4: 4,30 - 5: 2,33 - 6: 2,33 - 7: 4,33 - 8: 3,34 - 9: 1,33 - 10: 4,33 - 11: 4,34 - 12: 1,31 - 13: 3,30 - 14: 5,31 - 15: 8,31 - 1859: -61,-22 - 2104: -59,-32 - 2126: -60,-32 - 2483: -46,-24 + 1821: -61,-22 + 2066: -59,-32 + 2088: -60,-32 + 2445: -46,-24 + 5238: 2,38 + 5239: 4,38 + 5240: 5,39 + 5241: 7,39 + 5242: 8,38 + 5243: 9,37 + 5244: 10,38 + 5245: 7,37 + 5246: 2,35 + 5247: 1,36 + 5248: 1,40 + 5249: 11,37 + 5250: 8,39 + 5251: 9,38 + 5252: 10,41 + 5253: 10,42 + 5254: 7,40 + 5255: 1,40 + 5259: 4,37 + 5260: 6,38 + 5261: 10,34 + 5262: 10,35 + 5263: 2,37 + 5264: 2,34 + 5265: 1,34 + 5266: 9,34 + 5267: 8,37 - node: angle: 1.5707963267948966 rad color: '#FFFFFFFF' id: Dirt decals: - 4402: -78,-7 - 4403: -78,-5 - 4404: -79,-5 + 4275: -78,-7 + 4276: -78,-5 + 4277: -79,-5 - node: cleanable: True angle: 4.71238898038469 rad color: '#FFFFFFFF' id: Dirt decals: - 1994: -57,-11 + 1956: -57,-11 - node: cleanable: True color: '#484F45A1' id: DirtHeavy decals: - 3080: 0,-36 - 3081: 1,-36 + 3042: 0,-36 + 3043: 1,-36 - node: cleanable: True color: '#5600006B' id: DirtHeavy decals: - 2128: -59,-17 - 2129: -60,-17 - 2130: -61,-17 - 2131: -61,-14 - 2132: -54,-17 - 2133: -55,-17 - 2134: -53,-17 - 2135: -53,-14 - 2136: -53,-13 - 2137: -54,-13 - 2138: -62,-22 - 2139: -63,-22 - 2140: -62,-21 - 2141: -62,-22 - 2142: -63,-22 - 2143: -63,-21 - 2144: -61,-23 - 2145: -63,-23 - 2146: -63,-22 - - node: - color: '#655F6747' - id: DirtHeavy - decals: - 3597: 1,30 - 3598: 1,30 - 3599: 4,29 - 3600: 4,29 - 3601: 7,30 - 3602: 7,30 - 3603: 7,29 - 3604: 7,29 - 3605: 8,29 - 3606: 8,29 - 3607: 8,30 - 3608: 6,31 - 3609: 6,31 - 3610: 6,30 - 3611: 5,30 - 3612: 4,31 - 3613: 3,33 - 3614: 3,33 - 3615: 4,33 - 3616: 8,29 - 3623: 8,30 - 3624: 8,30 - 3625: 8,30 - 3626: 8,29 - 3627: 8,29 - 3628: 7,29 - 3629: 8,29 + 2090: -59,-17 + 2091: -60,-17 + 2092: -61,-17 + 2093: -61,-14 + 2094: -54,-17 + 2095: -55,-17 + 2096: -53,-17 + 2097: -53,-14 + 2098: -53,-13 + 2099: -54,-13 + 2100: -62,-22 + 2101: -63,-22 + 2102: -62,-21 + 2103: -62,-22 + 2104: -63,-22 + 2105: -63,-21 + 2106: -61,-23 + 2107: -63,-23 + 2108: -63,-22 - node: cleanable: True color: '#690000A8' id: DirtHeavy decals: - 2589: -47,-38 - 2590: -48,-41 + 2551: -47,-38 + 2552: -48,-41 - node: color: '#B18BDAFF' id: DirtHeavy decals: - 4138: -20,-41 - 4141: -16,-50 - 4142: -11,-60 + 4012: -20,-41 + 4014: -16,-50 + 4015: -11,-60 - node: cleanable: True angle: -0.4886921905584123 rad color: '#B8B9B88A' id: DirtHeavy decals: - 2015: -56,-11 + 1977: -56,-11 - node: cleanable: True color: '#C1B3BDBF' id: DirtHeavy decals: - 2222: -45,-21 - 2223: -46,-22 - 2224: -46,-22 - 2225: -46,-21 - 2226: -45,-20 - 2227: -42,-19 - 2228: -42,-19 - 2229: -41,-19 - 2230: -41,-21 - 2231: -41,-22 - 2232: -42,-22 - 2233: -42,-21 - 2234: -41,-21 - 2235: -41,-20 - 2236: -38,-19 - 2237: -37,-20 - 2238: -38,-20 - 2239: -38,-20 - 2240: -39,-20 - 2241: -39,-20 - 2242: -39,-21 - 2243: -39,-21 - 2244: -38,-22 - 2245: -39,-20 - 2246: -39,-22 - 2247: -38,-23 - 2248: -38,-23 - 2249: -38,-23 - 2250: -39,-25 - 2251: -39,-25 - 2252: -39,-26 - 2253: -39,-24 - 2254: -39,-24 - 2255: -37,-25 - 2256: -38,-26 - 2257: -36,-25 - 2258: -36,-26 - 2259: -36,-26 - 2260: -35,-26 - 2261: -35,-25 - 2262: -34,-26 - 2263: -34,-26 - 2264: -33,-25 - 2265: -30,-25 - 2266: -30,-25 - 2267: -31,-26 - 2268: -30,-26 - 2269: -29,-26 - 2270: -28,-26 - 2271: -28,-26 - 2272: -28,-26 - 2273: -27,-25 - 2274: -27,-24 - 2275: -28,-24 - 2276: -28,-24 - 2277: -29,-24 - 2278: -29,-25 - 2279: -28,-25 + 2184: -45,-21 + 2185: -46,-22 + 2186: -46,-22 + 2187: -46,-21 + 2188: -45,-20 + 2189: -42,-19 + 2190: -42,-19 + 2191: -41,-19 + 2192: -41,-21 + 2193: -41,-22 + 2194: -42,-22 + 2195: -42,-21 + 2196: -41,-21 + 2197: -41,-20 + 2198: -38,-19 + 2199: -37,-20 + 2200: -38,-20 + 2201: -38,-20 + 2202: -39,-20 + 2203: -39,-20 + 2204: -39,-21 + 2205: -39,-21 + 2206: -38,-22 + 2207: -39,-20 + 2208: -39,-22 + 2209: -38,-23 + 2210: -38,-23 + 2211: -38,-23 + 2212: -39,-25 + 2213: -39,-25 + 2214: -39,-26 + 2215: -39,-24 + 2216: -39,-24 + 2217: -37,-25 + 2218: -38,-26 + 2219: -36,-25 + 2220: -36,-26 + 2221: -36,-26 + 2222: -35,-26 + 2223: -35,-25 + 2224: -34,-26 + 2225: -34,-26 + 2226: -33,-25 + 2227: -30,-25 + 2228: -30,-25 + 2229: -31,-26 + 2230: -30,-26 + 2231: -29,-26 + 2232: -28,-26 + 2233: -28,-26 + 2234: -28,-26 + 2235: -27,-25 + 2236: -27,-24 + 2237: -28,-24 + 2238: -28,-24 + 2239: -29,-24 + 2240: -29,-25 + 2241: -28,-25 - node: color: '#D69949FF' id: DirtHeavy decals: - 40: 8,-28 - 41: 4,-26 + 9: 8,-28 + 10: 4,-26 - node: color: '#FFFFFF44' id: DirtHeavy decals: - 3630: 6,32 - 3631: 4,31 - 3632: 4,29 - 3633: 4,29 - 3634: 5,30 - 3635: 3,29 - 3636: 2,29 - 3638: 2,29 - 3640: 1,29 - 3641: 1,30 - 3642: 7,29 - 3643: 7,29 - 3644: 4,29 - 3645: 4,30 - 3646: 10,31 - 3647: 10,32 - 3648: 6,32 - 3649: 6,31 - 3650: 4,31 - 3651: 4,31 - 3652: 3,31 - 3654: 3,31 - 3655: 3,31 - 3657: 3,33 - 3658: 3,33 - 3659: 2,33 - 3660: 3,34 - 3661: 1,34 - 3662: 1,33 + 3562: 6,32 + 3565: 6,32 + 3568: 1,34 - node: color: '#FFFFFF58' id: DirtHeavy decals: - 4211: -35,-23 - 4212: -35,-22 - 4213: -34,-22 - 4214: -34,-23 - 4215: -35,-21 - 4216: -33,-22 - 4217: -33,-23 - 4218: -32,-23 - 4219: -32,-22 - 4220: -32,-21 - 4221: -32,-20 - 4222: -33,-19 - 4223: -33,-19 - 4224: -33,-18 - 4225: -35,-18 - 4226: -35,-18 - 4227: -35,-19 - 4228: -33,-16 - 4229: -34,-16 - 4230: -34,-17 - 4231: -34,-15 - 4232: -33,-15 - 4233: -33,-14 - 4234: -34,-14 - 4235: -35,-14 - 4236: -35,-15 - 4237: -35,-16 - 4238: -34,-15 - 4239: -36,-23 - 4240: -36,-22 - 4241: -36,-21 - 4242: -36,-20 - 4282: -31,-17 - 4283: -31,-16 - 4284: -30,-16 - 4285: -28,-16 - 4286: -27,-16 - 4287: -27,-16 - 4288: -27,-15 + 4084: -35,-23 + 4085: -35,-22 + 4086: -34,-22 + 4087: -34,-23 + 4088: -35,-21 + 4089: -33,-22 + 4090: -33,-23 + 4091: -32,-23 + 4092: -32,-22 + 4093: -32,-21 + 4094: -32,-20 + 4095: -33,-19 + 4096: -33,-19 + 4097: -33,-18 + 4098: -35,-18 + 4099: -35,-18 + 4100: -35,-19 + 4101: -33,-16 + 4102: -34,-16 + 4103: -34,-17 + 4104: -34,-15 + 4105: -33,-15 + 4106: -33,-14 + 4107: -34,-14 + 4108: -35,-14 + 4109: -35,-15 + 4110: -35,-16 + 4111: -34,-15 + 4112: -36,-23 + 4113: -36,-22 + 4114: -36,-21 + 4115: -36,-20 + 4155: -31,-17 + 4156: -31,-16 + 4157: -30,-16 + 4158: -28,-16 + 4159: -27,-16 + 4160: -27,-16 + 4161: -27,-15 - node: cleanable: True color: '#FFFFFF5D' id: DirtHeavy decals: - 3248: 7,-15 + 3210: 7,-15 - node: cleanable: True color: '#FFFFFF6B' id: DirtHeavy decals: - 2127: -59,-17 + 2089: -59,-17 - node: cleanable: True color: '#FFFFFF72' id: DirtHeavy decals: - 4739: -42,-32 - 4740: -43,-32 - 4741: -44,-31 - 4742: -43,-30 + 4566: -42,-32 + 4567: -43,-32 + 4568: -44,-31 + 4569: -43,-30 - node: cleanable: True color: '#FFFFFF78' id: DirtHeavy decals: - 4527: -18,-15 - 4528: -19,-14 - 4529: -20,-15 - 4530: -16,-14 - 4531: -17,-13 - 4532: -15,-13 - 4533: -12,-13 - 4534: -11,-14 - 4535: -8,-12 - 4536: -9,-11 - 4537: -12,-10 - 4538: -14,-9 - 4539: -13,-9 - 4540: -13,-11 - 4541: -8,-16 - 4542: -7,-15 - 4543: -7,-14 - 4544: -9,-16 - 4545: -20,-11 - 4546: -20,-11 - 4547: -20,-10 - 4548: -21,-10 - 4549: -19,-8 - 4550: -19,-7 - 4551: -21,-6 - 4552: -22,-6 - 4553: -22,-5 - 4554: -22,-4 - 4555: -21,-5 - 4556: -20,-5 - 4557: -20,-5 - 4558: -19,-6 - 4559: -20,-8 - 4560: -16,-11 - 4561: -17,-11 - 4562: -17,-10 - 4563: -15,-10 - 4564: -15,-11 - 4565: -29,-3 - 4566: -30,-2 - 4567: -30,-1 - 4568: -30,0 - 4569: -29,0 - 4570: -29,-3 - 4571: -29,-4 - 4572: -29,-5 - 4573: -29,-6 - 4574: -27,-6 - 4575: -28,-6 - 4576: -26,-6 - 4577: -25,-6 - 4578: -24,-6 - 4579: -24,-5 - 4580: -25,-4 - 4581: -26,-4 - 4582: -27,-4 - 4583: -27,-3 - 4584: -27,-2 - 4585: -26,-2 - 4586: -25,-2 - 4587: -25,-3 - 4588: -24,-3 - 4589: -24,-2 - 4590: -24,-1 - 4591: -25,0 - 4592: -26,0 - 4593: -25,2 - 4594: -25,3 - 4595: -24,2 - 4596: -25,4 - 4597: -24,4 - 4598: -24,5 - 4599: -25,7 - 4600: -24,7 - 4601: -24,8 - 4602: -25,8 - 4603: -25,9 - 4604: -25,10 - 4605: -24,10 - 4606: -24,11 - 4607: -25,11 - 4608: -25,12 - 4609: -24,12 - 4610: -24,13 - 4611: -25,14 - 4612: -24,14 - 4613: -24,15 - 4614: -25,15 - 4615: -26,17 - 4616: -27,17 - 4617: -28,17 - 4618: -28,18 - 4619: -28,20 - 4620: -26,18 - 4621: -25,18 - 4622: -26,19 - 4623: -26,19 - 4624: -24,19 - 4625: -24,18 - 4626: -23,18 - 4627: -23,19 - 4628: -23,18 - 4629: -23,17 - 4630: -22,17 - 4631: -22,17 - 4632: -22,18 - 4633: -22,19 - 4634: -25,-10 - 4635: -25,-8 - 4636: -24,-8 - 4637: -23,-8 - 4638: -23,-9 - 4639: -23,-10 - 4640: -23,-11 - 4641: -25,-13 - 4642: -25,-14 - 4643: -23,-13 - 4644: -23,-14 - 4645: -23,-15 - 4646: -25,-16 - 4647: -25,-17 - 4648: -24,-17 - 4649: -23,-17 - 4650: -21,-15 - 4651: -25,-19 - 4652: -24,-19 - 4653: -23,-19 - 4654: -23,-21 - 4655: -25,-21 - 4656: -25,-22 - 4657: -23,-23 - 4658: -25,-24 - 4659: -25,-25 - 4660: -25,-26 - 4661: -23,-26 - 4662: -23,-25 - 4663: -23,-24 - 4664: -25,-27 - 4665: -23,-27 - 4666: -23,-28 - 4667: -25,-29 - 4668: -25,-30 - 4669: -23,-30 - 4670: -23,-31 - 4671: -23,-32 - 4672: -24,-32 - 4673: -25,-32 - 4674: -25,-31 - 4675: -60,0 - 4676: -61,0 - 4677: -62,0 - 4678: -64,0 - 4679: -64,-2 - 4680: -63,-2 - 4681: -62,-2 - 4682: -60,-2 - 4683: -58,-2 - 4684: -57,-2 - 4685: -55,-2 - 4686: -56,-2 - 4687: -54,-2 - 4688: -54,-1 - 4689: -54,0 - 4690: -55,0 - 4691: -57,0 - 4692: -58,0 - 4693: -51,-3 - 4694: -52,-3 - 4695: -52,-1 - 4696: -52,0 - 4697: -51,0 - 4698: -51,1 - 4699: -50,0 - 4700: -50,-2 - 4701: -49,0 - 4702: -49,-2 - 4703: -50,-2 - 4704: -48,0 - 4705: -47,-2 - 4706: -45,-2 - 4707: -46,0 - 4708: -47,0 - 4709: -45,0 - 4710: -44,0 - 4711: -47,-2 - 4712: -43,-2 - 4713: -42,-2 - 4714: -43,0 - 4715: -42,0 - 4716: -41,0 - 4717: -40,0 - 4718: -38,0 - 4719: -38,1 - 4720: -39,0 - 4721: -35,-2 - 4722: -34,-2 - 4723: -34,0 - 4724: -36,0 - 4725: -36,0 - 4726: -38,1 - 4727: -32,0 - 4728: -32,-1 - 4729: -32,-2 - 4730: -39,-2 - 4731: -38,-2 + 4354: -18,-15 + 4355: -19,-14 + 4356: -20,-15 + 4357: -16,-14 + 4358: -17,-13 + 4359: -15,-13 + 4360: -12,-13 + 4361: -11,-14 + 4362: -8,-12 + 4363: -9,-11 + 4364: -12,-10 + 4365: -14,-9 + 4366: -13,-9 + 4367: -13,-11 + 4368: -8,-16 + 4369: -7,-15 + 4370: -7,-14 + 4371: -9,-16 + 4372: -20,-11 + 4373: -20,-11 + 4374: -20,-10 + 4375: -21,-10 + 4376: -19,-8 + 4377: -19,-7 + 4378: -21,-6 + 4379: -22,-6 + 4380: -22,-5 + 4381: -22,-4 + 4382: -21,-5 + 4383: -20,-5 + 4384: -20,-5 + 4385: -19,-6 + 4386: -20,-8 + 4387: -16,-11 + 4388: -17,-11 + 4389: -17,-10 + 4390: -15,-10 + 4391: -15,-11 + 4392: -29,-3 + 4393: -30,-2 + 4394: -30,-1 + 4395: -30,0 + 4396: -29,0 + 4397: -29,-3 + 4398: -29,-4 + 4399: -29,-5 + 4400: -29,-6 + 4401: -27,-6 + 4402: -28,-6 + 4403: -26,-6 + 4404: -25,-6 + 4405: -24,-6 + 4406: -24,-5 + 4407: -25,-4 + 4408: -26,-4 + 4409: -27,-4 + 4410: -27,-3 + 4411: -27,-2 + 4412: -26,-2 + 4413: -25,-2 + 4414: -25,-3 + 4415: -24,-3 + 4416: -24,-2 + 4417: -24,-1 + 4418: -25,0 + 4419: -26,0 + 4420: -25,2 + 4421: -25,3 + 4422: -24,2 + 4423: -25,4 + 4424: -24,4 + 4425: -24,5 + 4426: -25,7 + 4427: -24,7 + 4428: -24,8 + 4429: -25,8 + 4430: -25,9 + 4431: -25,10 + 4432: -24,10 + 4433: -24,11 + 4434: -25,11 + 4435: -25,12 + 4436: -24,12 + 4437: -24,13 + 4438: -25,14 + 4439: -24,14 + 4440: -24,15 + 4441: -25,15 + 4442: -26,17 + 4443: -27,17 + 4444: -28,17 + 4445: -28,18 + 4446: -28,20 + 4447: -26,18 + 4448: -25,18 + 4449: -26,19 + 4450: -26,19 + 4451: -24,19 + 4452: -24,18 + 4453: -23,18 + 4454: -23,19 + 4455: -23,18 + 4456: -23,17 + 4457: -22,17 + 4458: -22,17 + 4459: -22,18 + 4460: -22,19 + 4461: -25,-10 + 4462: -25,-8 + 4463: -24,-8 + 4464: -23,-8 + 4465: -23,-9 + 4466: -23,-10 + 4467: -23,-11 + 4468: -25,-13 + 4469: -25,-14 + 4470: -23,-13 + 4471: -23,-14 + 4472: -23,-15 + 4473: -25,-16 + 4474: -25,-17 + 4475: -24,-17 + 4476: -23,-17 + 4477: -21,-15 + 4478: -25,-19 + 4479: -24,-19 + 4480: -23,-19 + 4481: -23,-21 + 4482: -25,-21 + 4483: -25,-22 + 4484: -23,-23 + 4485: -25,-24 + 4486: -25,-25 + 4487: -25,-26 + 4488: -23,-26 + 4489: -23,-25 + 4490: -23,-24 + 4491: -25,-27 + 4492: -23,-27 + 4493: -23,-28 + 4494: -25,-29 + 4495: -25,-30 + 4496: -23,-30 + 4497: -23,-31 + 4498: -23,-32 + 4499: -24,-32 + 4500: -25,-32 + 4501: -25,-31 + 4502: -60,0 + 4503: -61,0 + 4504: -62,0 + 4505: -64,0 + 4506: -64,-2 + 4507: -63,-2 + 4508: -62,-2 + 4509: -60,-2 + 4510: -58,-2 + 4511: -57,-2 + 4512: -55,-2 + 4513: -56,-2 + 4514: -54,-2 + 4515: -54,-1 + 4516: -54,0 + 4517: -55,0 + 4518: -57,0 + 4519: -58,0 + 4520: -51,-3 + 4521: -52,-3 + 4522: -52,-1 + 4523: -52,0 + 4524: -51,0 + 4525: -51,1 + 4526: -50,0 + 4527: -50,-2 + 4528: -49,0 + 4529: -49,-2 + 4530: -50,-2 + 4531: -48,0 + 4532: -47,-2 + 4533: -45,-2 + 4534: -46,0 + 4535: -47,0 + 4536: -45,0 + 4537: -44,0 + 4538: -47,-2 + 4539: -43,-2 + 4540: -42,-2 + 4541: -43,0 + 4542: -42,0 + 4543: -41,0 + 4544: -40,0 + 4545: -38,0 + 4546: -38,1 + 4547: -39,0 + 4548: -35,-2 + 4549: -34,-2 + 4550: -34,0 + 4551: -36,0 + 4552: -36,0 + 4553: -38,1 + 4554: -32,0 + 4555: -32,-1 + 4556: -32,-2 + 4557: -39,-2 + 4558: -38,-2 - node: color: '#FFFFFF82' id: DirtHeavy decals: - 4293: -35,-11 - 4294: -35,-10 - 4295: -35,-10 - 4296: -36,-11 - 4297: -36,-12 - 4298: -36,-12 - 4299: -35,-12 - 4300: -36,-10 - 4301: -34,-12 - 4302: -33,-12 - 4303: -33,-11 - 4304: -33,-9 - 4305: -32,-9 - 4306: -32,-10 - 4307: -33,-10 - 4308: -31,-10 - 4309: -31,-9 - 4310: -31,-11 - 4311: -32,-11 - 4312: -32,-12 - 4313: -30,-12 - 4314: -30,-13 - 4315: -30,-11 - 4316: -29,-13 - 4317: -29,-13 - 4318: -27,-13 - 4319: -27,-13 - 4320: -27,-12 - 4321: -27,-12 - 4322: -28,-13 - 4323: -28,-12 - 4324: -28,-10 - 4325: -29,-10 - 4326: -29,-9 - 4327: -30,-9 - 4328: -29,-8 - 4329: -27,-9 - 4330: -27,-8 - 4331: -28,-9 + 4166: -35,-11 + 4167: -35,-10 + 4168: -35,-10 + 4169: -36,-11 + 4170: -36,-12 + 4171: -36,-12 + 4172: -35,-12 + 4173: -36,-10 + 4174: -34,-12 + 4175: -33,-12 + 4176: -33,-11 + 4177: -33,-9 + 4178: -32,-9 + 4179: -32,-10 + 4180: -33,-10 + 4181: -31,-10 + 4182: -31,-9 + 4183: -31,-11 + 4184: -32,-11 + 4185: -32,-12 + 4186: -30,-12 + 4187: -30,-13 + 4188: -30,-11 + 4189: -29,-13 + 4190: -29,-13 + 4191: -27,-13 + 4192: -27,-13 + 4193: -27,-12 + 4194: -27,-12 + 4195: -28,-13 + 4196: -28,-12 + 4197: -28,-10 + 4198: -29,-10 + 4199: -29,-9 + 4200: -30,-9 + 4201: -29,-8 + 4202: -27,-9 + 4203: -27,-8 + 4204: -28,-9 - node: color: '#FFFFFF93' id: DirtHeavy decals: - 4818: 4,-28 - 4819: 5,-28 - 4820: 5,-27 - 4821: 3,-27 - 4822: 3,-26 - 4823: 2,-26 - 4824: 2,-27 - 4825: 3,-25 - 4826: 3,-24 - 4827: 4,-25 - 4828: 5,-25 - 4829: 6,-25 - 4830: 8,-25 - 4831: 9,-25 - 4832: 9,-26 - 4833: 9,-27 - 4834: 10,-28 - 4835: 8,-29 - 4836: 6,-28 - 4837: 7,-28 - 4838: 7,-27 - 4839: 6,-27 - 4840: 6,-26 - 4841: 7,-26 - 4842: 8,-31 - 4843: 8,-32 - 4844: 9,-32 - 4845: 9,-33 - 4846: 8,-34 - 4847: 4,-31 - 4848: 4,-30 - 4849: 5,-30 - 4850: 5,-31 - 4851: 4,-31 - 4852: 4,-33 - 4853: 4,-32 - 4854: 2,-32 - 4855: 2,-31 - 4856: 2,-30 - 4857: 0,-31 - 4858: -1,-31 - 4859: -2,-31 - 4860: -2,-30 - 4861: 12,-28 - 4862: 13,-28 - 4863: 13,-29 - 4864: 13,-29 - 4865: 12,-26 - 4866: 13,-26 - 4867: 13,-25 + 4640: 4,-28 + 4641: 5,-28 + 4642: 5,-27 + 4643: 3,-27 + 4644: 3,-26 + 4645: 2,-26 + 4646: 2,-27 + 4647: 3,-25 + 4648: 3,-24 + 4649: 4,-25 + 4650: 5,-25 + 4651: 6,-25 + 4652: 8,-25 + 4653: 9,-25 + 4654: 9,-26 + 4655: 9,-27 + 4656: 10,-28 + 4657: 8,-29 + 4658: 6,-28 + 4659: 7,-28 + 4660: 7,-27 + 4661: 6,-27 + 4662: 6,-26 + 4663: 7,-26 + 4664: 8,-31 + 4665: 8,-32 + 4666: 9,-32 + 4667: 9,-33 + 4668: 8,-34 + 4669: 4,-31 + 4670: 4,-30 + 4671: 5,-30 + 4672: 5,-31 + 4673: 4,-31 + 4674: 4,-33 + 4675: 4,-32 + 4676: 2,-32 + 4677: 2,-31 + 4678: 2,-30 + 4679: 0,-31 + 4680: -1,-31 + 4681: -2,-31 + 4682: -2,-30 + 4683: 12,-28 + 4684: 13,-28 + 4685: 13,-29 + 4686: 13,-29 + 4687: 12,-26 + 4688: 13,-26 + 4689: 13,-25 - node: color: '#FFFFFF99' id: DirtHeavy decals: - 3751: -46,8 - 3752: -45,7 - 3753: -45,8 - 3754: -44,8 - 3755: -44,7 - 3756: -43,7 - 3757: -43,8 - 3758: -42,8 - 3759: -42,7 - 3760: -41,8 - 3761: -40,8 - 3762: -46,3 - 3763: -47,5 - 3764: -47,7 - 3765: -47,7 - 3766: -47,7 - 3767: -47,8 - 3768: -41,9 - 3769: -43,7 - 3770: -46,8 - 3771: -40,8 - 3772: -38,3 - 3773: -37,3 - 3774: -34,4 - 3775: -34,5 - 3776: -40,3 - 3777: -38,3 - 3778: -38,3 - 3779: -38,4 - 3780: -38,4 - 3781: -35,4 - 3782: -32,5 - 3783: -32,6 - 3784: -32,6 - 3785: -32,5 - 3786: -35,10 - 3787: -35,10 - 3788: -38,13 - 3789: -38,14 - 3790: -37,15 - 3791: -35,15 - 3792: -34,14 - 3793: -34,13 - 3794: -35,12 - 3795: -37,12 - 3796: -37,12 - 3797: -36,12 - 3798: -37,15 - 3799: -36,15 - 3800: -32,10 - 3801: -30,10 - 3802: -30,10 - 3803: -29,10 - 3804: -29,11 - 3805: -30,11 - 3806: -31,11 - 3807: -31,10 - 3808: -32,10 - 3809: -32,11 - 3810: -28,10 - 3811: -28,11 - 3812: -29,9 - 3813: -30,9 - 3814: -31,9 - 3815: -31,9 - 3816: -35,9 - 3817: -36,9 - 3818: -39,9 - 3819: -46,11 - 3820: -45,11 - 3821: -47,11 - 3822: -45,12 - 3823: -45,13 - 3824: -45,14 - 3825: -45,14 - 3826: -45,15 - 3827: -46,15 - 3828: -47,15 - 3829: -48,15 - 3830: -48,14 - 3831: -47,14 - 3832: -46,13 - 3833: -41,15 - 3834: -41,14 - 3835: -41,14 - 3836: -41,12 - 3837: -44,19 - 3838: -46,19 - 3839: -44,21 - 3840: -46,22 + 3638: -46,8 + 3639: -45,7 + 3640: -45,8 + 3641: -44,8 + 3642: -44,7 + 3643: -43,7 + 3644: -43,8 + 3645: -42,8 + 3646: -42,7 + 3647: -41,8 + 3648: -40,8 + 3649: -46,3 + 3650: -47,5 + 3651: -47,7 + 3652: -47,7 + 3653: -47,7 + 3654: -47,8 + 3655: -41,9 + 3656: -43,7 + 3657: -46,8 + 3658: -40,8 + 3659: -38,3 + 3660: -37,3 + 3661: -34,4 + 3662: -34,5 + 3663: -40,3 + 3664: -38,3 + 3665: -38,3 + 3666: -38,4 + 3667: -38,4 + 3668: -35,4 + 3669: -32,5 + 3670: -32,6 + 3671: -32,6 + 3672: -32,5 + 3673: -35,10 + 3674: -35,10 + 3675: -38,13 + 3676: -38,14 + 3677: -37,15 + 3678: -35,15 + 3679: -34,14 + 3680: -34,13 + 3681: -35,12 + 3682: -37,12 + 3683: -37,12 + 3684: -36,12 + 3685: -37,15 + 3686: -36,15 + 3687: -32,10 + 3688: -30,10 + 3689: -30,10 + 3690: -29,10 + 3691: -29,11 + 3692: -30,11 + 3693: -31,11 + 3694: -31,10 + 3695: -32,10 + 3696: -32,11 + 3697: -28,10 + 3698: -28,11 + 3699: -29,9 + 3700: -30,9 + 3701: -31,9 + 3702: -31,9 + 3703: -35,9 + 3704: -36,9 + 3705: -39,9 + 3706: -46,11 + 3707: -45,11 + 3708: -47,11 + 3709: -45,12 + 3710: -45,13 + 3711: -45,14 + 3712: -45,14 + 3713: -45,15 + 3714: -46,15 + 3715: -47,15 + 3716: -48,15 + 3717: -48,14 + 3718: -47,14 + 3719: -46,13 + 3720: -41,15 + 3721: -41,14 + 3722: -41,14 + 3723: -41,12 - node: color: '#FFFFFFA3' id: DirtHeavy decals: - 1873: -70,-10 - 1874: -72,-9 - 1875: -72,-8 - 1876: -62,-12 - 1877: -61,-11 + 1835: -70,-10 + 1836: -72,-9 + 1837: -72,-8 + 1838: -62,-12 + 1839: -61,-11 - node: cleanable: True color: '#FFFFFFCC' id: DirtHeavy decals: - 4525: -19,-15 - 4526: -16,-13 + 4352: -19,-15 + 4353: -16,-13 - node: color: '#FFFFFFFF' id: DirtHeavy decals: - 63: -15,-5 - 64: -15,-5 - 65: -15,-6 - 66: -16,-8 - 67: -16,-5 - 68: -16,-6 - 69: -15,-8 - 70: -15,-8 - 1866: -70,-9 - 1867: -71,-10 - 1868: -72,-10 - 1869: -71,-9 - 1870: -71,-8 - 1871: -70,-8 - 1872: -70,-10 - 3259: 6,-23 - 3336: -1,21 - 3337: -1,22 - 3338: -1,23 - 3339: 0,23 - 3340: 0,22 - 3341: 2,22 - 3342: 2,22 - 3343: 2,22 - 3344: 1,22 - 3345: 2,22 - 3346: 2,22 - 3347: 1,23 - 3348: 2,22 - 3349: 1,22 - 3352: 2,23 - 3353: 2,23 - 3354: 9,23 - 3355: 9,22 - 3356: 10,22 - 3357: 10,23 - 3358: 11,23 - 3359: 11,23 - 3360: 11,22 - 3361: 12,22 - 3362: 14,23 - 3363: 13,23 - 3364: 13,23 - 3365: 12,23 - 3366: 12,23 - 3367: 13,22 - 3368: 13,22 - 3369: 14,21 - 3370: 14,22 - 3371: 14,20 - 3372: 14,20 - 3373: 13,21 - 3374: 13,21 - 3375: 14,15 - 3376: 14,13 - 3377: 12,14 - 3378: 13,14 - 3379: 14,15 - 3380: 14,16 - 3381: 13,16 - 3382: 13,17 - 3383: 13,19 - 3384: 13,20 - 3385: 16,20 - 3386: 16,20 - 3387: 17,20 - 3388: 16,18 - 3389: 15,18 - 3390: 16,18 - 3391: 17,18 - 3392: 17,18 - 3393: 18,18 - 3394: 18,19 - 3395: 12,12 - 3396: 13,12 - 3397: 14,12 - 3398: 14,13 - 3399: 14,14 - 3400: 14,14 - 3401: 13,14 - 3402: 11,12 - 3403: 11,12 - 3404: 11,12 - 3405: 12,10 - 3406: 11,10 - 3407: 12,10 - 3408: 12,9 - 3409: 12,9 - 3410: 12,8 - 3411: 12,8 - 3412: 12,8 - 3413: 11,8 - 3414: 11,8 - 3415: 10,7 - 3416: 10,6 - 3417: 12,5 - 3418: 13,5 - 3419: 13,5 - 3420: 13,6 - 3421: 12,6 - 3422: 12,3 - 3423: 12,3 - 3424: 12,3 - 3425: 14,3 - 3426: 14,3 - 3427: 15,3 - 3428: 15,3 - 3429: 15,4 - 3430: 15,5 - 3431: 15,7 - 3432: 15,7 - 3433: 15,8 - 3434: 15,8 - 3435: 13,9 - 3436: 17,10 - 3437: 17,10 - 3438: 16,10 - 3439: 16,10 - 3440: 15,10 - 3441: 15,10 - 3442: 17,10 - 3443: 18,10 - 3444: 18,10 - 3445: 18,11 - 3446: 19,10 - 3447: 19,9 - 3448: 19,9 - 3449: 17,8 - 3450: 17,8 - 3451: 19,8 - 3452: 19,9 - 3453: 18,8 - 3454: 18,8 - 3455: 19,10 - 3462: -19,3 - 3463: -19,4 - 3464: -18,3 - 3465: -20,3 - 3466: -21,4 - 3467: -21,3 - 3468: -21,4 - 3469: -21,5 - 3470: -22,3 - 3471: -22,6 - 3472: -21,7 - 3473: -22,7 - 3474: -22,7 - 3475: -22,9 - 3476: -22,10 - 3477: -22,11 - 3478: -22,11 - 3479: -22,12 - 3480: -22,12 - 3481: -20,11 - 3482: -20,11 - 3483: -20,10 - 3484: -20,9 - 3485: -16,2 - 3486: -15,3 - 3487: -15,3 - 3488: -15,4 - 3489: -16,4 - 3490: -16,4 - 3491: -16,5 - 3492: -15,5 - 3493: -15,5 - 3494: -15,7 - 3495: -15,8 - 3496: -15,8 - 3497: -15,7 - 3498: -16,5 - 3499: -16,5 - 3505: -35,18 - 3506: -35,17 - 3507: -36,17 - 3508: -34,17 - 3509: -34,17 - 3510: -33,18 - 3511: -32,18 - 3512: -32,18 - 3513: -32,17 - 3514: -31,17 - 3515: -30,17 - 3516: -30,17 - 3517: -31,17 - 3518: -32,17 - 3519: -49,17 - 3520: -50,17 - 3521: -51,16 - 3522: -51,16 - 3523: -51,16 - 3524: -51,15 - 3525: -51,15 - 3526: -51,13 - 3527: -51,13 - 3528: -51,12 - 3529: -49,13 - 3530: -50,13 - 3531: -50,14 - 3532: -50,15 - 3533: -50,15 - 3534: -50,13 - 3535: -50,12 - 3536: -50,10 - 3537: -50,10 - 3538: -50,11 - 3539: -44,17 - 3540: -43,17 - 3541: -42,17 - 3542: -40,18 - 3543: -50,11 - 3544: -50,9 - 3545: -50,8 - 3546: -51,9 - 3547: -51,9 - 3548: -51,8 - 3549: -51,6 - 3550: -51,6 - 3551: -51,5 - 3552: -50,6 - 3553: -50,6 - 3554: -51,4 - 3555: -51,4 - 3556: -51,3 - 3557: -50,3 - 3558: -50,3 - 3559: -51,4 - 3560: -51,5 - 3561: -51,6 - 3562: -50,5 - 3563: -50,5 - 3670: 6,30 - 3671: 3,29 - 3672: 1,29 - 3673: 2,29 - 3847: -32,2 - 3848: -31,2 - 3849: -33,17 - 3850: -33,17 - 3866: -38,12 - 3867: -34,12 - 3979: -44,3 - 3980: -43,2 - 3981: -42,3 - 3984: -48,8 + 32: -15,-5 + 33: -15,-5 + 34: -15,-6 + 35: -16,-8 + 36: -16,-5 + 37: -16,-6 + 38: -15,-8 + 39: -15,-8 + 1828: -70,-9 + 1829: -71,-10 + 1830: -72,-10 + 1831: -71,-9 + 1832: -71,-8 + 1833: -70,-8 + 1834: -70,-10 + 3221: 6,-23 + 3298: -1,21 + 3299: -1,22 + 3300: -1,23 + 3301: 0,23 + 3302: 0,22 + 3303: 2,22 + 3304: 2,22 + 3305: 2,22 + 3306: 1,22 + 3307: 2,22 + 3308: 2,22 + 3309: 1,23 + 3310: 2,22 + 3311: 1,22 + 3314: 2,23 + 3315: 2,23 + 3316: 9,23 + 3317: 9,22 + 3318: 10,22 + 3319: 10,23 + 3320: 11,23 + 3321: 11,23 + 3322: 11,22 + 3323: 12,22 + 3324: 14,23 + 3325: 13,23 + 3326: 13,23 + 3327: 12,23 + 3328: 12,23 + 3329: 13,22 + 3330: 13,22 + 3331: 14,21 + 3332: 14,22 + 3333: 14,20 + 3334: 14,20 + 3335: 13,21 + 3336: 13,21 + 3337: 14,15 + 3338: 14,13 + 3339: 12,14 + 3340: 13,14 + 3341: 14,15 + 3342: 14,16 + 3343: 13,16 + 3344: 13,17 + 3345: 13,19 + 3346: 13,20 + 3347: 16,20 + 3348: 16,20 + 3349: 17,20 + 3350: 16,18 + 3351: 15,18 + 3352: 16,18 + 3353: 17,18 + 3354: 17,18 + 3355: 18,18 + 3356: 18,19 + 3357: 12,12 + 3358: 13,12 + 3359: 14,12 + 3360: 14,13 + 3361: 14,14 + 3362: 14,14 + 3363: 13,14 + 3364: 11,12 + 3365: 11,12 + 3366: 11,12 + 3367: 12,10 + 3368: 11,10 + 3369: 12,10 + 3370: 12,9 + 3371: 12,9 + 3372: 12,8 + 3373: 12,8 + 3374: 12,8 + 3375: 11,8 + 3376: 11,8 + 3377: 10,7 + 3378: 10,6 + 3379: 12,5 + 3380: 13,5 + 3381: 13,5 + 3382: 13,6 + 3383: 12,6 + 3384: 12,3 + 3385: 12,3 + 3386: 12,3 + 3387: 14,3 + 3388: 14,3 + 3389: 15,3 + 3390: 15,3 + 3391: 15,4 + 3392: 15,5 + 3393: 15,7 + 3394: 15,7 + 3395: 15,8 + 3396: 15,8 + 3397: 13,9 + 3398: 17,10 + 3399: 17,10 + 3400: 16,10 + 3401: 16,10 + 3402: 15,10 + 3403: 15,10 + 3404: 17,10 + 3405: 18,10 + 3406: 18,10 + 3407: 18,11 + 3408: 19,10 + 3409: 19,9 + 3410: 19,9 + 3411: 17,8 + 3412: 17,8 + 3413: 19,8 + 3414: 19,9 + 3415: 18,8 + 3416: 18,8 + 3417: 19,10 + 3424: -19,3 + 3425: -19,4 + 3426: -18,3 + 3427: -20,3 + 3428: -21,4 + 3429: -21,3 + 3430: -21,4 + 3431: -21,5 + 3432: -22,3 + 3433: -22,6 + 3434: -21,7 + 3435: -22,7 + 3436: -22,7 + 3437: -22,9 + 3438: -22,10 + 3439: -22,11 + 3440: -22,11 + 3441: -22,12 + 3442: -22,12 + 3443: -20,11 + 3444: -20,11 + 3445: -20,10 + 3446: -20,9 + 3447: -16,2 + 3448: -15,3 + 3449: -15,3 + 3450: -15,4 + 3451: -16,4 + 3452: -16,4 + 3453: -16,5 + 3454: -15,5 + 3455: -15,5 + 3456: -15,7 + 3457: -15,8 + 3458: -15,8 + 3459: -15,7 + 3460: -16,5 + 3461: -16,5 + 3467: -35,18 + 3468: -35,17 + 3469: -36,17 + 3470: -34,17 + 3471: -34,17 + 3472: -33,18 + 3473: -32,18 + 3474: -32,18 + 3475: -32,17 + 3476: -31,17 + 3477: -30,17 + 3478: -30,17 + 3479: -31,17 + 3480: -32,17 + 3481: -49,17 + 3482: -50,17 + 3483: -51,16 + 3484: -51,16 + 3485: -51,16 + 3486: -51,15 + 3487: -51,15 + 3488: -51,13 + 3489: -51,13 + 3490: -51,12 + 3491: -49,13 + 3492: -50,13 + 3493: -50,14 + 3494: -50,15 + 3495: -50,15 + 3496: -50,13 + 3497: -50,12 + 3498: -50,10 + 3499: -50,10 + 3500: -50,11 + 3501: -44,17 + 3502: -43,17 + 3503: -42,17 + 3504: -40,18 + 3505: -50,11 + 3506: -50,9 + 3507: -50,8 + 3508: -51,9 + 3509: -51,9 + 3510: -51,8 + 3511: -51,6 + 3512: -51,6 + 3513: -51,5 + 3514: -50,6 + 3515: -50,6 + 3516: -51,4 + 3517: -51,4 + 3518: -51,3 + 3519: -50,3 + 3520: -50,3 + 3521: -51,4 + 3522: -51,5 + 3523: -51,6 + 3524: -50,5 + 3525: -50,5 + 3730: -32,2 + 3731: -31,2 + 3732: -33,17 + 3733: -33,17 + 3748: -38,12 + 3749: -34,12 + 3861: -44,3 + 3862: -43,2 + 3863: -42,3 + 3866: -48,8 - node: cleanable: True color: '#FFFFFFFF' id: DirtHeavy decals: - 16: 6,29 - 17: 6,29 - 18: 6,29 - 19: 5,29 - 20: 5,29 - 21: 3,30 - 22: 2,31 - 23: 1,31 - 24: 7,31 - 25: 8,31 - 26: 10,31 - 1655: -40,-2 - 1656: -37,-2 - 1657: -33,-2 - 1658: -27,0 - 1659: -24,-4 - 1660: -25,-9 - 1661: -23,-12 - 1662: -25,-15 - 1663: -23,-16 - 1664: -25,-20 - 1665: -23,-20 - 1666: -23,-22 - 1667: -25,-23 - 1668: -24,-26 - 1669: -25,-28 - 1670: -23,-29 - 1671: -25,-11 - 1672: -20,0 - 1673: -18,-2 - 1674: -17,-1 - 1675: -14,-1 - 1676: -13,-2 - 1677: -7,0 - 1678: -10,0 - 1679: -8,-1 - 1680: -8,0 - 1681: -24,0 - 1682: -24,3 - 1683: -25,5 - 1684: -24,6 - 1685: -25,6 - 1686: -24,9 - 1687: -25,13 - 1688: -24,17 - 1689: -27,18 - 1690: -27,19 - 1691: -25,17 - 1692: -48,-2 - 1693: -52,-2 - 1694: -51,-2 - 1695: -56,0 - 1696: -61,-2 - 1697: -60,-1 - 1698: -63,0 - 1699: -64,-1 - 1700: -68,0 - 1701: -68,-3 - 1702: -59,0 - 1703: -59,-2 - 1704: -67,-2 - 1705: -69,-3 - 1706: -73,-4 - 1707: -73,-3 - 1708: -73,0 - 1709: -71,0 - 1710: -16,-34 - 1711: -18,-39 - 1712: -26,-34 - 1713: -33,-34 - 1714: -34,-36 - 1715: -38,-34 - 1716: -40,-35 - 1717: -41,-35 - 1718: -43,-34 - 1719: -45,-34 - 1720: -45,-35 - 1721: -52,-35 - 1722: -55,-34 - 1723: -56,-35 - 1724: -58,-34 - 1725: -56,-34 - 1726: -49,-36 - 1727: -52,-36 - 1728: -45,-36 - 1729: -50,-36 - 1730: -59,-36 - 1731: -60,-35 - 1732: -47,-35 - 1733: -47,-34 - 1734: -52,-32 - 1735: -53,-30 - 1736: -52,-28 - 1737: -52,-29 - 1738: -53,-21 - 1739: -53,-22 - 1740: -52,-24 - 1741: -9,-34 - 1742: -12,-36 - 1743: -5,-33 - 1744: -3,-34 - 1745: -3,-29 - 1746: -4,-27 - 1747: -5,-28 - 1748: -4,-31 - 1749: -1,-30 - 1750: -1,-26 - 1751: -4,-25 - 1752: -5,-24 - 1753: -3,-23 - 1754: -4,-21 - 1755: -3,2 - 1756: -4,7 - 1757: -3,10 - 1758: -4,12 - 1759: -2,17 - 1760: -4,18 - 1761: -4,19 - 1762: 1,-1 - 1763: 4,-1 - 1764: 6,0 - 1765: 7,-2 - 1766: 10,-2 - 1767: 8,-2 - 1768: 13,-2 - 1769: 16,0 - 1770: 17,0 - 1771: 19,-2 - 1772: 18,0 - 1773: 23,-1 - 1774: 23,-2 - 1775: 17,-1 - 1776: 28,-1 - 1777: 29,-2 - 1778: 26,-1 - 1779: 22,0 - 1780: 22,-1 - 1781: 25,-2 - 1782: 30,-1 - 1783: 33,-1 - 1784: 34,0 - 1785: 35,-2 - 1786: 35,2 - 1787: 34,5 - 1788: 37,4 - 1789: 38,6 - 1790: 35,7 - 1791: 34,10 - 1792: 35,11 - 1793: 34,14 - 1794: 34,19 - 1795: 21,14 - 1796: 22,12 - 1797: 22,10 - 1798: 22,19 - 1799: 20,19 - 1800: 22,17 - 1801: 21,8 - 1802: 22,4 - 1803: 21,3 - 1804: -28,-8 - 1805: -30,-10 - 1806: -34,-10 - 1807: -34,-11 - 1808: -45,-12 - 1809: -33,-17 - 1810: -34,-18 - 1811: -35,-20 - 1812: -33,-21 - 1813: -19,-26 - 1814: -16,-26 - 1815: -16,-22 - 1816: -18,-20 - 1817: -17,-28 - 1818: -12,-28 - 1819: -9,-27 - 1820: -10,-25 - 1821: -7,-26 - 1822: -7,-22 - 1823: -41,13 - 1824: -40,17 - 1825: -42,18 - 1826: 2,30 - 1827: -55,-5 - 1828: -60,-4 - 1829: -61,-9 - 1830: -64,-6 - 1831: 9,-34 - 1832: 8,-33 - 1833: 9,-31 - 1834: 9,-29 - 1835: 9,-28 - 1836: 4,-27 - 1837: 5,-26 - 1838: 7,-25 - 1839: 10,-26 - 1840: 3,-32 - 1841: 3,-31 - 1842: 0,-30 - 1843: -17,-42 - 1844: -15,-50 - 1845: -16,-53 - 1846: -15,-61 - 1847: -16,-65 - 1848: -17,-68 - 1849: -10,-68 - 1850: -11,-64 - 1851: -12,-62 - 1852: -19,0 - 1853: -28,0 - 1854: -29,-2 - 1855: -11,0 - 1856: -29,-16 - 1857: -31,-16 - 1858: -43,-14 - 1860: -61,-21 - 1861: -62,-23 - 1862: -61,-23 - 1863: -62,-21 - 1864: -63,-23 - 1865: -61,-20 - 1885: -76,-7 - 1886: -75,-7 - 1887: -75,-6 - 1888: -75,-6 - 1889: -76,-6 - 1890: -76,-6 - 1891: -76,-6 - 1892: -74,-7 - 1893: -74,-7 - 1894: -73,-6 - 1895: -73,-6 - 1896: -74,-6 - 1897: -71,-6 - 1898: -70,-6 - 1899: -70,-6 - 1900: -68,-6 - 1901: -67,-6 - 1902: -66,-6 - 1903: -66,-7 - 1904: -67,-7 - 1905: -67,-8 - 1906: -66,-8 - 1907: -66,-9 - 1908: -67,-10 - 1909: -67,-11 - 1910: -66,-11 - 1911: -66,-11 - 1912: -66,-11 - 1913: -65,-12 - 1914: -65,-12 - 1915: -67,-12 - 1916: -66,-12 - 1917: -64,-12 - 1918: -63,-12 - 1919: -64,-11 - 1920: -64,-11 - 1921: -63,-11 - 1922: -63,-12 - 1923: -62,-11 - 1924: -61,-11 - 1925: -60,-11 - 1926: -59,-11 - 1927: -58,-11 - 1928: -57,-10 - 1929: -56,-10 - 1930: -55,-10 - 1931: -55,-11 - 1932: -54,-11 - 1933: -54,-11 - 1934: -53,-10 - 1935: -54,-9 - 1936: -55,-9 - 1937: -55,-9 - 1938: -55,-11 - 1939: -54,-9 - 1940: -57,-9 - 2017: -61,-12 - 2018: -62,-14 - 2019: -61,-16 - 2020: -61,-16 - 2021: -61,-16 - 2022: -61,-18 - 2023: -61,-18 - 2024: -62,-16 - 2025: -62,-16 - 2026: -62,-14 - 2027: -62,-14 - 2028: -62,-15 - 2029: -60,-17 - 2030: -60,-17 - 2031: -57,-17 - 2032: -56,-17 - 2033: -55,-17 - 2034: -59,-18 - 2035: -59,-19 - 2076: -58,-18 - 2077: -53,-18 - 2078: -53,-18 - 2079: -53,-16 - 2080: -53,-16 - 2081: -53,-15 - 2082: -53,-13 - 2083: -54,-13 - 2084: -54,-13 - 2085: -52,-14 - 2086: -53,-14 - 2087: -52,-14 - 2088: -59,-20 - 2089: -59,-20 - 2090: -59,-22 - 2091: -59,-24 - 2092: -59,-25 - 2093: -59,-26 - 2094: -59,-28 - 2095: -59,-29 - 2096: -59,-31 - 2097: -59,-32 - 2098: -59,-32 - 2099: -59,-31 - 2100: -59,-30 - 2101: -59,-28 - 2102: -59,-28 - 2103: -59,-27 - 2157: -61,-15 - 2158: -61,-15 - 2175: -52,-13 - 2176: -53,-10 - 2177: -52,-14 - 2178: -51,-15 - 2179: -50,-14 - 2180: -53,-6 - 2181: -51,-8 - 2182: -52,-7 - 2183: -52,-5 - 2184: -51,-8 - 2185: -52,-7 - 2186: -52,-5 - 2187: -52,-13 - 2188: -50,-14 - 2189: -51,-17 - 2190: -51,-18 - 2191: -50,-18 - 2192: -50,-17 - 2193: -50,-17 - 2194: -50,-15 - 2195: -49,-18 - 2196: -48,-18 - 2197: -47,-18 - 2198: -46,-19 - 2199: -46,-18 - 2200: -46,-19 - 2201: -46,-18 - 2202: -47,-18 - 2203: -48,-18 - 2204: -50,-18 - 2205: -50,-15 - 2206: -50,-15 - 2394: -42,-26 - 2395: -42,-25 - 2396: -42,-25 - 2397: -41,-24 - 2398: -41,-25 - 2399: -41,-26 - 2400: -41,-26 - 2401: -42,-25 - 2402: -42,-24 - 2403: -45,-28 - 2404: -46,-28 - 2405: -42,-28 - 2406: -42,-28 - 2407: -41,-28 - 2408: -42,-28 - 2409: -43,-28 - 2410: -43,-28 - 2411: -43,-28 - 2412: -37,-28 - 2413: -37,-28 - 2414: -40,-28 - 2415: -40,-28 - 2416: -40,-28 - 2417: -37,-28 - 2418: -37,-29 - 2419: -37,-29 - 2420: -38,-29 - 2421: -37,-29 - 2422: -37,-30 - 2423: -38,-30 - 2424: -38,-31 - 2425: -38,-31 - 2426: -38,-32 - 2427: -37,-31 - 2428: -38,-30 - 2429: -37,-32 - 2430: -36,-32 - 2431: -36,-32 - 2432: -35,-32 - 2433: -34,-32 - 2434: -34,-32 - 2435: -33,-32 - 2491: -55,-42 - 2492: -55,-42 - 2493: -55,-43 - 2494: -55,-44 - 2495: -54,-44 - 2496: -54,-44 - 2497: -53,-44 - 2498: -53,-45 - 2499: -55,-45 - 2500: -51,-44 - 2501: -51,-44 - 2502: -51,-45 - 2503: -50,-42 - 2504: -52,-41 - 2505: -54,-42 - 2506: -54,-40 - 2507: -53,-39 - 2508: -52,-39 - 2509: -52,-39 - 2510: -52,-39 - 2511: -52,-38 - 2512: -52,-38 - 2513: -51,-38 - 2514: -51,-38 - 2515: -53,-39 - 2516: -54,-40 - 2591: -48,-38 - 2592: -48,-39 - 2593: -48,-39 - 2594: -47,-38 - 2595: -47,-39 - 2596: -47,-40 - 2597: -48,-41 - 2598: -48,-41 - 2599: -48,-43 - 2600: -48,-43 - 2601: -48,-44 - 2602: -47,-43 - 2603: -47,-43 - 2604: -48,-42 - 2605: -49,-44 - 2606: -49,-45 - 2607: -49,-45 - 2608: -49,-46 - 2609: -49,-47 - 2610: -49,-47 - 2611: -49,-48 - 2612: -49,-48 - 2613: -51,-48 - 2614: -51,-47 - 2615: -51,-47 - 2616: -52,-47 - 2617: -52,-48 - 2618: -50,-47 - 2619: -50,-47 - 2620: -51,-47 - 2621: -52,-47 - 2622: -51,-47 - 2623: -49,-49 - 2624: -48,-50 - 2625: -49,-50 - 2626: -48,-50 - 2627: -47,-50 - 2628: -47,-49 - 2629: -48,-49 - 2630: -47,-49 - 2631: -45,-50 - 2632: -44,-50 - 2633: -45,-49 - 2634: -44,-49 - 2635: -43,-50 - 2636: -44,-50 - 2637: -45,-49 - 2638: -44,-49 - 2639: -43,-49 - 2640: -43,-50 - 2641: -42,-50 - 2642: -41,-50 - 2643: -41,-49 - 2644: -42,-49 - 2645: -42,-49 - 2646: -42,-50 - 2647: -42,-52 - 2648: -42,-53 - 2649: -42,-53 - 2650: -43,-53 - 2651: -43,-52 - 2652: -43,-52 - 2653: -42,-52 - 2654: -41,-53 - 2655: -41,-52 - 2656: -41,-52 - 2657: -40,-52 - 2658: -41,-53 - 2659: -41,-50 - 2660: -40,-49 - 2661: -40,-49 - 2662: -39,-49 - 2663: -38,-50 - 2664: -38,-50 - 2665: -38,-50 - 2666: -38,-49 - 2667: -39,-49 - 2668: -38,-50 - 2669: -36,-50 - 2670: -36,-50 - 2671: -36,-52 - 2672: -36,-53 - 2673: -36,-53 - 2674: -37,-53 - 2675: -37,-52 - 2676: -38,-52 - 2677: -36,-50 - 2678: -35,-49 - 2679: -35,-49 - 2680: -35,-49 - 2681: -35,-48 - 2682: -35,-48 - 2683: -35,-47 - 2684: -35,-47 - 2685: -35,-46 - 2686: -35,-46 - 2687: -33,-50 - 2688: -33,-49 - 2689: -34,-49 - 2690: -34,-49 - 2691: -33,-50 - 2692: -32,-50 - 2693: -32,-50 - 2694: -32,-49 - 2695: -31,-49 - 2696: -30,-50 - 2697: -29,-50 - 2698: -29,-50 - 2699: -30,-49 - 2700: -29,-49 - 2701: -29,-49 - 2702: -30,-49 - 2703: -30,-49 - 2802: -33,-54 - 2803: -34,-54 - 2804: -33,-53 - 2805: -32,-54 - 2806: -32,-52 - 2807: -33,-52 - 2808: -34,-53 - 2809: -33,-53 - 2846: -32,-46 - 2847: -32,-46 - 2848: -33,-47 - 2849: -33,-47 - 2850: -32,-45 - 2851: -31,-45 - 2852: -32,-44 - 2853: -32,-44 - 2854: -31,-44 - 2855: -31,-42 - 2856: -31,-42 - 2857: -32,-41 - 2858: -33,-41 - 2859: -33,-41 - 2860: -33,-41 - 2861: -35,-41 - 2862: -35,-41 - 2863: -35,-42 - 2864: -36,-41 - 2865: -36,-43 - 2866: -35,-43 - 2867: -31,-44 - 2868: -33,-44 - 2869: -32,-47 - 2876: -29,-46 - 2877: -29,-47 - 2878: -28,-46 - 2879: -27,-47 - 2880: -27,-47 - 2881: -26,-46 - 2882: -26,-46 - 2883: -28,-46 - 2884: -28,-46 - 2885: -27,-46 - 2886: -29,-46 - 2887: -28,-47 - 2888: -27,-49 - 2889: -26,-50 - 2890: -26,-50 - 2891: -26,-49 - 2892: -29,-43 - 2893: -29,-42 - 2894: -29,-41 - 2895: -29,-41 - 2896: -29,-40 - 2897: -30,-40 - 2898: -31,-39 - 2899: -31,-39 - 2900: -29,-39 - 2901: -29,-39 - 2902: -25,-46 - 2903: -24,-46 - 2904: -24,-46 - 2905: -24,-47 - 2906: -24,-47 - 2907: -24,-46 - 2908: -25,-46 - 2909: -24,-47 - 2910: -24,-48 - 2911: -23,-49 - 2912: -24,-50 - 2913: -24,-50 - 2914: -23,-50 - 2915: -22,-49 - 2916: -22,-50 - 2917: -21,-50 - 2918: -21,-49 - 2919: -21,-50 - 2920: -22,-50 - 2921: -20,-50 - 2922: -20,-50 - 2923: -20,-49 - 2924: -20,-49 - 2925: -21,-49 - 2926: -22,-49 - 2946: -12,-49 - 2947: -12,-50 - 2948: -11,-50 - 2949: -9,-47 - 2950: -9,-47 - 2951: -9,-47 - 2952: -9,-46 - 2953: -9,-45 - 2954: -9,-42 - 2955: -9,-40 - 2956: -9,-39 - 2957: -10,-39 - 2958: -12,-39 - 2959: -13,-39 - 2960: -14,-39 - 2961: -14,-39 - 2962: -14,-39 - 2963: -14,-41 - 2964: -14,-41 - 2965: -14,-42 - 2966: -14,-42 - 2967: -14,-43 - 2968: -14,-43 - 2969: -14,-42 - 2970: -14,-40 - 2971: -14,-40 - 2972: -14,-40 - 2973: -14,-40 - 2974: -15,-38 - 2975: -15,-38 - 3011: 1,-35 - 3012: 0,-35 - 3013: -1,-35 - 3014: -1,-36 - 3015: -1,-35 - 3016: 0,-34 - 3017: 0,-33 - 3018: 0,-37 - 3019: 1,-39 - 3020: 1,-39 - 3021: 1,-38 - 3022: 1,-38 - 3023: 3,-35 - 3024: 3,-35 - 3025: 3,-36 - 3026: 3,-37 - 3027: 4,-35 - 3028: 2,-36 - 3029: 3,-35 - 3030: 4,-35 - 3031: 4,-36 - 3032: 5,-35 - 3033: 5,-36 - 3034: 7,-36 - 3035: 6,-36 - 3036: 6,-36 - 3037: 8,-38 - 3038: 9,-38 - 3039: 10,-38 - 3040: 10,-37 - 3041: 10,-36 - 3042: 10,-36 - 3043: 9,-36 - 3044: 9,-36 - 3045: 8,-37 - 3046: 7,-38 - 3047: 7,-38 - 3048: 7,-38 - 3049: 7,-38 - 3050: 6,-37 - 3051: 6,-38 - 3052: 5,-38 - 3053: 5,-38 - 3054: 4,-38 - 3055: 3,-38 - 3056: 3,-38 - 3057: 5,-37 - 3131: 0,-19 - 3132: 0,-20 - 3133: 1,-20 - 3134: 1,-19 - 3135: 2,-19 - 3136: 2,-19 - 3137: 3,-20 - 3138: 3,-19 - 3139: 3,-21 - 3140: 3,-21 - 3141: 3,-22 - 3142: 4,-22 - 3143: 5,-22 - 3144: 5,-22 - 3145: 7,-23 - 3146: 7,-23 - 3147: 6,-22 - 3148: 7,-22 - 3149: 8,-23 - 3150: 9,-23 - 3151: 9,-23 - 3152: 9,-22 - 3153: 9,-22 - 3154: 10,-23 - 3155: 10,-23 - 3156: 7,-22 - 3157: 10,-20 - 3158: 10,-19 - 3159: 10,-19 - 3160: 10,-18 - 3161: 10,-17 - 3162: 10,-15 - 3163: 10,-15 - 3164: 8,-15 - 3165: 4,-15 - 3166: 6,-15 - 3167: 6,-15 - 3168: 5,-15 - 3169: 5,-14 - 3170: 5,-13 - 3171: 5,-13 - 3172: 6,-14 - 3173: 6,-12 - 3174: 6,-12 - 3175: 5,-12 - 3176: 8,-12 - 3177: 8,-13 - 3178: 9,-13 - 3179: 8,-12 - 3180: 7,-12 - 3181: 9,-12 - 3182: 10,-13 - 3183: 11,-13 - 3184: 11,-12 - 3185: 11,-11 - 3186: 11,-11 - 3187: 10,-10 - 3188: 10,-9 - 3189: 10,-9 - 3190: 10,-8 - 3191: 11,-8 - 3192: 12,-9 - 3193: 12,-9 - 3194: 11,-9 - 3195: 11,-6 - 3196: 10,-6 - 3197: 10,-6 - 3198: 10,-5 - 3199: 10,-5 - 3200: 11,-6 - 3201: 11,-7 - 3202: 11,-7 - 3203: 13,-12 - 3204: 13,-11 - 3205: 14,-11 - 3206: 14,-11 - 3207: 14,-12 - 3208: 15,-12 - 3209: 15,-11 - 3851: -37,3 - 3865: -36,10 - 3878: -36,3 - 3884: -38,5 - 3885: -37,5 - 3886: -35,5 - 3887: -36,5 - 3888: -35,5 - 3926: -54,2 - 3927: -54,3 - 3928: -54,4 - 3929: -54,6 - 3930: -55,4 - 3931: -55,3 - 3932: -55,2 - 3933: -53,2 - 3934: -53,3 - 3935: -53,4 - 3936: -53,6 - 3937: -55,6 - 3945: -37,8 - 3946: -36,8 - 3947: -34,8 - 3948: -35,8 - 3951: -34,9 - 3952: -37,9 - 3953: -27,10 - 4014: -39,8 - 4015: -39,7 - 4017: -40,7 - 4018: -41,7 - 4019: -39,10 - 4020: -40,10 - 4021: -43,9 - 4022: -44,9 - 4023: -45,9 - 4024: -48,9 - 4025: -47,9 - 4029: -46,6 - 4031: -46,7 - 4332: -47,-10 - 4335: -40,-11 - 4337: -43,-10 - 4374: -53,-25 - 4390: -41,-12 - 4906: -1,14 - 4907: 0,13 - 4908: 0,14 - 4909: -1,11 - 4910: 0,10 - 4911: -1,9 - 4912: -1,9 - 4913: 0,9 - 4914: -1,10 - 4915: 0,11 - 4916: 0,14 + 1618: -40,-2 + 1619: -37,-2 + 1620: -33,-2 + 1621: -27,0 + 1622: -24,-4 + 1623: -25,-9 + 1624: -23,-12 + 1625: -25,-15 + 1626: -23,-16 + 1627: -25,-20 + 1628: -23,-20 + 1629: -23,-22 + 1630: -25,-23 + 1631: -24,-26 + 1632: -25,-28 + 1633: -23,-29 + 1634: -25,-11 + 1635: -20,0 + 1636: -18,-2 + 1637: -17,-1 + 1638: -14,-1 + 1639: -13,-2 + 1640: -7,0 + 1641: -10,0 + 1642: -8,-1 + 1643: -8,0 + 1644: -24,0 + 1645: -24,3 + 1646: -25,5 + 1647: -24,6 + 1648: -25,6 + 1649: -24,9 + 1650: -25,13 + 1651: -24,17 + 1652: -27,18 + 1653: -27,19 + 1654: -25,17 + 1655: -48,-2 + 1656: -52,-2 + 1657: -51,-2 + 1658: -56,0 + 1659: -61,-2 + 1660: -60,-1 + 1661: -63,0 + 1662: -64,-1 + 1663: -68,0 + 1664: -68,-3 + 1665: -59,0 + 1666: -59,-2 + 1667: -67,-2 + 1668: -69,-3 + 1669: -73,-4 + 1670: -73,-3 + 1671: -73,0 + 1672: -71,0 + 1673: -16,-34 + 1674: -18,-39 + 1675: -26,-34 + 1676: -33,-34 + 1677: -34,-36 + 1678: -38,-34 + 1679: -40,-35 + 1680: -41,-35 + 1681: -43,-34 + 1682: -45,-34 + 1683: -45,-35 + 1684: -52,-35 + 1685: -55,-34 + 1686: -56,-35 + 1687: -58,-34 + 1688: -56,-34 + 1689: -49,-36 + 1690: -52,-36 + 1691: -45,-36 + 1692: -50,-36 + 1693: -59,-36 + 1694: -60,-35 + 1695: -47,-35 + 1696: -47,-34 + 1697: -52,-32 + 1698: -53,-30 + 1699: -52,-28 + 1700: -52,-29 + 1701: -53,-21 + 1702: -53,-22 + 1703: -52,-24 + 1704: -9,-34 + 1705: -12,-36 + 1706: -5,-33 + 1707: -3,-34 + 1708: -3,-29 + 1709: -4,-27 + 1710: -5,-28 + 1711: -4,-31 + 1712: -1,-30 + 1713: -1,-26 + 1714: -4,-25 + 1715: -5,-24 + 1716: -3,-23 + 1717: -4,-21 + 1718: -3,2 + 1719: -4,7 + 1720: -3,10 + 1721: -4,12 + 1722: -2,17 + 1723: -4,18 + 1724: -4,19 + 1725: 1,-1 + 1726: 4,-1 + 1727: 6,0 + 1728: 7,-2 + 1729: 10,-2 + 1730: 8,-2 + 1731: 13,-2 + 1732: 16,0 + 1733: 17,0 + 1734: 19,-2 + 1735: 18,0 + 1736: 23,-1 + 1737: 23,-2 + 1738: 17,-1 + 1739: 28,-1 + 1740: 29,-2 + 1741: 26,-1 + 1742: 22,0 + 1743: 22,-1 + 1744: 25,-2 + 1745: 30,-1 + 1746: 33,-1 + 1747: 34,0 + 1748: 35,-2 + 1749: 35,2 + 1750: 34,5 + 1751: 37,4 + 1752: 38,6 + 1753: 35,7 + 1754: 34,10 + 1755: 35,11 + 1756: 34,14 + 1757: 34,19 + 1758: 21,14 + 1759: 22,12 + 1760: 22,10 + 1761: 22,19 + 1762: 20,19 + 1763: 22,17 + 1764: 21,8 + 1765: 22,4 + 1766: 21,3 + 1767: -28,-8 + 1768: -30,-10 + 1769: -34,-10 + 1770: -34,-11 + 1771: -45,-12 + 1772: -33,-17 + 1773: -34,-18 + 1774: -35,-20 + 1775: -33,-21 + 1776: -19,-26 + 1777: -16,-26 + 1778: -16,-22 + 1779: -18,-20 + 1780: -17,-28 + 1781: -12,-28 + 1782: -9,-27 + 1783: -10,-25 + 1784: -7,-26 + 1785: -7,-22 + 1786: -41,13 + 1787: -40,17 + 1788: -42,18 + 1789: -55,-5 + 1790: -60,-4 + 1791: -61,-9 + 1792: -64,-6 + 1793: 9,-34 + 1794: 8,-33 + 1795: 9,-31 + 1796: 9,-29 + 1797: 9,-28 + 1798: 4,-27 + 1799: 5,-26 + 1800: 7,-25 + 1801: 10,-26 + 1802: 3,-32 + 1803: 3,-31 + 1804: 0,-30 + 1805: -17,-42 + 1806: -15,-50 + 1807: -16,-53 + 1808: -15,-61 + 1809: -16,-65 + 1810: -17,-68 + 1811: -10,-68 + 1812: -11,-64 + 1813: -12,-62 + 1814: -19,0 + 1815: -28,0 + 1816: -29,-2 + 1817: -11,0 + 1818: -29,-16 + 1819: -31,-16 + 1820: -43,-14 + 1822: -61,-21 + 1823: -62,-23 + 1824: -61,-23 + 1825: -62,-21 + 1826: -63,-23 + 1827: -61,-20 + 1847: -76,-7 + 1848: -75,-7 + 1849: -75,-6 + 1850: -75,-6 + 1851: -76,-6 + 1852: -76,-6 + 1853: -76,-6 + 1854: -74,-7 + 1855: -74,-7 + 1856: -73,-6 + 1857: -73,-6 + 1858: -74,-6 + 1859: -71,-6 + 1860: -70,-6 + 1861: -70,-6 + 1862: -68,-6 + 1863: -67,-6 + 1864: -66,-6 + 1865: -66,-7 + 1866: -67,-7 + 1867: -67,-8 + 1868: -66,-8 + 1869: -66,-9 + 1870: -67,-10 + 1871: -67,-11 + 1872: -66,-11 + 1873: -66,-11 + 1874: -66,-11 + 1875: -65,-12 + 1876: -65,-12 + 1877: -67,-12 + 1878: -66,-12 + 1879: -64,-12 + 1880: -63,-12 + 1881: -64,-11 + 1882: -64,-11 + 1883: -63,-11 + 1884: -63,-12 + 1885: -62,-11 + 1886: -61,-11 + 1887: -60,-11 + 1888: -59,-11 + 1889: -58,-11 + 1890: -57,-10 + 1891: -56,-10 + 1892: -55,-10 + 1893: -55,-11 + 1894: -54,-11 + 1895: -54,-11 + 1896: -53,-10 + 1897: -54,-9 + 1898: -55,-9 + 1899: -55,-9 + 1900: -55,-11 + 1901: -54,-9 + 1902: -57,-9 + 1979: -61,-12 + 1980: -62,-14 + 1981: -61,-16 + 1982: -61,-16 + 1983: -61,-16 + 1984: -61,-18 + 1985: -61,-18 + 1986: -62,-16 + 1987: -62,-16 + 1988: -62,-14 + 1989: -62,-14 + 1990: -62,-15 + 1991: -60,-17 + 1992: -60,-17 + 1993: -57,-17 + 1994: -56,-17 + 1995: -55,-17 + 1996: -59,-18 + 1997: -59,-19 + 2038: -58,-18 + 2039: -53,-18 + 2040: -53,-18 + 2041: -53,-16 + 2042: -53,-16 + 2043: -53,-15 + 2044: -53,-13 + 2045: -54,-13 + 2046: -54,-13 + 2047: -52,-14 + 2048: -53,-14 + 2049: -52,-14 + 2050: -59,-20 + 2051: -59,-20 + 2052: -59,-22 + 2053: -59,-24 + 2054: -59,-25 + 2055: -59,-26 + 2056: -59,-28 + 2057: -59,-29 + 2058: -59,-31 + 2059: -59,-32 + 2060: -59,-32 + 2061: -59,-31 + 2062: -59,-30 + 2063: -59,-28 + 2064: -59,-28 + 2065: -59,-27 + 2119: -61,-15 + 2120: -61,-15 + 2137: -52,-13 + 2138: -53,-10 + 2139: -52,-14 + 2140: -51,-15 + 2141: -50,-14 + 2142: -53,-6 + 2143: -51,-8 + 2144: -52,-7 + 2145: -52,-5 + 2146: -51,-8 + 2147: -52,-7 + 2148: -52,-5 + 2149: -52,-13 + 2150: -50,-14 + 2151: -51,-17 + 2152: -51,-18 + 2153: -50,-18 + 2154: -50,-17 + 2155: -50,-17 + 2156: -50,-15 + 2157: -49,-18 + 2158: -48,-18 + 2159: -47,-18 + 2160: -46,-19 + 2161: -46,-18 + 2162: -46,-19 + 2163: -46,-18 + 2164: -47,-18 + 2165: -48,-18 + 2166: -50,-18 + 2167: -50,-15 + 2168: -50,-15 + 2356: -42,-26 + 2357: -42,-25 + 2358: -42,-25 + 2359: -41,-24 + 2360: -41,-25 + 2361: -41,-26 + 2362: -41,-26 + 2363: -42,-25 + 2364: -42,-24 + 2365: -45,-28 + 2366: -46,-28 + 2367: -42,-28 + 2368: -42,-28 + 2369: -41,-28 + 2370: -42,-28 + 2371: -43,-28 + 2372: -43,-28 + 2373: -43,-28 + 2374: -37,-28 + 2375: -37,-28 + 2376: -40,-28 + 2377: -40,-28 + 2378: -40,-28 + 2379: -37,-28 + 2380: -37,-29 + 2381: -37,-29 + 2382: -38,-29 + 2383: -37,-29 + 2384: -37,-30 + 2385: -38,-30 + 2386: -38,-31 + 2387: -38,-31 + 2388: -38,-32 + 2389: -37,-31 + 2390: -38,-30 + 2391: -37,-32 + 2392: -36,-32 + 2393: -36,-32 + 2394: -35,-32 + 2395: -34,-32 + 2396: -34,-32 + 2397: -33,-32 + 2453: -55,-42 + 2454: -55,-42 + 2455: -55,-43 + 2456: -55,-44 + 2457: -54,-44 + 2458: -54,-44 + 2459: -53,-44 + 2460: -53,-45 + 2461: -55,-45 + 2462: -51,-44 + 2463: -51,-44 + 2464: -51,-45 + 2465: -50,-42 + 2466: -52,-41 + 2467: -54,-42 + 2468: -54,-40 + 2469: -53,-39 + 2470: -52,-39 + 2471: -52,-39 + 2472: -52,-39 + 2473: -52,-38 + 2474: -52,-38 + 2475: -51,-38 + 2476: -51,-38 + 2477: -53,-39 + 2478: -54,-40 + 2553: -48,-38 + 2554: -48,-39 + 2555: -48,-39 + 2556: -47,-38 + 2557: -47,-39 + 2558: -47,-40 + 2559: -48,-41 + 2560: -48,-41 + 2561: -48,-43 + 2562: -48,-43 + 2563: -48,-44 + 2564: -47,-43 + 2565: -47,-43 + 2566: -48,-42 + 2567: -49,-44 + 2568: -49,-45 + 2569: -49,-45 + 2570: -49,-46 + 2571: -49,-47 + 2572: -49,-47 + 2573: -49,-48 + 2574: -49,-48 + 2575: -51,-48 + 2576: -51,-47 + 2577: -51,-47 + 2578: -52,-47 + 2579: -52,-48 + 2580: -50,-47 + 2581: -50,-47 + 2582: -51,-47 + 2583: -52,-47 + 2584: -51,-47 + 2585: -49,-49 + 2586: -48,-50 + 2587: -49,-50 + 2588: -48,-50 + 2589: -47,-50 + 2590: -47,-49 + 2591: -48,-49 + 2592: -47,-49 + 2593: -45,-50 + 2594: -44,-50 + 2595: -45,-49 + 2596: -44,-49 + 2597: -43,-50 + 2598: -44,-50 + 2599: -45,-49 + 2600: -44,-49 + 2601: -43,-49 + 2602: -43,-50 + 2603: -42,-50 + 2604: -41,-50 + 2605: -41,-49 + 2606: -42,-49 + 2607: -42,-49 + 2608: -42,-50 + 2609: -42,-52 + 2610: -42,-53 + 2611: -42,-53 + 2612: -43,-53 + 2613: -43,-52 + 2614: -43,-52 + 2615: -42,-52 + 2616: -41,-53 + 2617: -41,-52 + 2618: -41,-52 + 2619: -40,-52 + 2620: -41,-53 + 2621: -41,-50 + 2622: -40,-49 + 2623: -40,-49 + 2624: -39,-49 + 2625: -38,-50 + 2626: -38,-50 + 2627: -38,-50 + 2628: -38,-49 + 2629: -39,-49 + 2630: -38,-50 + 2631: -36,-50 + 2632: -36,-50 + 2633: -36,-52 + 2634: -36,-53 + 2635: -36,-53 + 2636: -37,-53 + 2637: -37,-52 + 2638: -38,-52 + 2639: -36,-50 + 2640: -35,-49 + 2641: -35,-49 + 2642: -35,-49 + 2643: -35,-48 + 2644: -35,-48 + 2645: -35,-47 + 2646: -35,-47 + 2647: -35,-46 + 2648: -35,-46 + 2649: -33,-50 + 2650: -33,-49 + 2651: -34,-49 + 2652: -34,-49 + 2653: -33,-50 + 2654: -32,-50 + 2655: -32,-50 + 2656: -32,-49 + 2657: -31,-49 + 2658: -30,-50 + 2659: -29,-50 + 2660: -29,-50 + 2661: -30,-49 + 2662: -29,-49 + 2663: -29,-49 + 2664: -30,-49 + 2665: -30,-49 + 2764: -33,-54 + 2765: -34,-54 + 2766: -33,-53 + 2767: -32,-54 + 2768: -32,-52 + 2769: -33,-52 + 2770: -34,-53 + 2771: -33,-53 + 2808: -32,-46 + 2809: -32,-46 + 2810: -33,-47 + 2811: -33,-47 + 2812: -32,-45 + 2813: -31,-45 + 2814: -32,-44 + 2815: -32,-44 + 2816: -31,-44 + 2817: -31,-42 + 2818: -31,-42 + 2819: -32,-41 + 2820: -33,-41 + 2821: -33,-41 + 2822: -33,-41 + 2823: -35,-41 + 2824: -35,-41 + 2825: -35,-42 + 2826: -36,-41 + 2827: -36,-43 + 2828: -35,-43 + 2829: -31,-44 + 2830: -33,-44 + 2831: -32,-47 + 2838: -29,-46 + 2839: -29,-47 + 2840: -28,-46 + 2841: -27,-47 + 2842: -27,-47 + 2843: -26,-46 + 2844: -26,-46 + 2845: -28,-46 + 2846: -28,-46 + 2847: -27,-46 + 2848: -29,-46 + 2849: -28,-47 + 2850: -27,-49 + 2851: -26,-50 + 2852: -26,-50 + 2853: -26,-49 + 2854: -29,-43 + 2855: -29,-42 + 2856: -29,-41 + 2857: -29,-41 + 2858: -29,-40 + 2859: -30,-40 + 2860: -31,-39 + 2861: -31,-39 + 2862: -29,-39 + 2863: -29,-39 + 2864: -25,-46 + 2865: -24,-46 + 2866: -24,-46 + 2867: -24,-47 + 2868: -24,-47 + 2869: -24,-46 + 2870: -25,-46 + 2871: -24,-47 + 2872: -24,-48 + 2873: -23,-49 + 2874: -24,-50 + 2875: -24,-50 + 2876: -23,-50 + 2877: -22,-49 + 2878: -22,-50 + 2879: -21,-50 + 2880: -21,-49 + 2881: -21,-50 + 2882: -22,-50 + 2883: -20,-50 + 2884: -20,-50 + 2885: -20,-49 + 2886: -20,-49 + 2887: -21,-49 + 2888: -22,-49 + 2908: -12,-49 + 2909: -12,-50 + 2910: -11,-50 + 2911: -9,-47 + 2912: -9,-47 + 2913: -9,-47 + 2914: -9,-46 + 2915: -9,-45 + 2916: -9,-42 + 2917: -9,-40 + 2918: -9,-39 + 2919: -10,-39 + 2920: -12,-39 + 2921: -13,-39 + 2922: -14,-39 + 2923: -14,-39 + 2924: -14,-39 + 2925: -14,-41 + 2926: -14,-41 + 2927: -14,-42 + 2928: -14,-42 + 2929: -14,-43 + 2930: -14,-43 + 2931: -14,-42 + 2932: -14,-40 + 2933: -14,-40 + 2934: -14,-40 + 2935: -14,-40 + 2936: -15,-38 + 2937: -15,-38 + 2973: 1,-35 + 2974: 0,-35 + 2975: -1,-35 + 2976: -1,-36 + 2977: -1,-35 + 2978: 0,-34 + 2979: 0,-33 + 2980: 0,-37 + 2981: 1,-39 + 2982: 1,-39 + 2983: 1,-38 + 2984: 1,-38 + 2985: 3,-35 + 2986: 3,-35 + 2987: 3,-36 + 2988: 3,-37 + 2989: 4,-35 + 2990: 2,-36 + 2991: 3,-35 + 2992: 4,-35 + 2993: 4,-36 + 2994: 5,-35 + 2995: 5,-36 + 2996: 7,-36 + 2997: 6,-36 + 2998: 6,-36 + 2999: 8,-38 + 3000: 9,-38 + 3001: 10,-38 + 3002: 10,-37 + 3003: 10,-36 + 3004: 10,-36 + 3005: 9,-36 + 3006: 9,-36 + 3007: 8,-37 + 3008: 7,-38 + 3009: 7,-38 + 3010: 7,-38 + 3011: 7,-38 + 3012: 6,-37 + 3013: 6,-38 + 3014: 5,-38 + 3015: 5,-38 + 3016: 4,-38 + 3017: 3,-38 + 3018: 3,-38 + 3019: 5,-37 + 3093: 0,-19 + 3094: 0,-20 + 3095: 1,-20 + 3096: 1,-19 + 3097: 2,-19 + 3098: 2,-19 + 3099: 3,-20 + 3100: 3,-19 + 3101: 3,-21 + 3102: 3,-21 + 3103: 3,-22 + 3104: 4,-22 + 3105: 5,-22 + 3106: 5,-22 + 3107: 7,-23 + 3108: 7,-23 + 3109: 6,-22 + 3110: 7,-22 + 3111: 8,-23 + 3112: 9,-23 + 3113: 9,-23 + 3114: 9,-22 + 3115: 9,-22 + 3116: 10,-23 + 3117: 10,-23 + 3118: 7,-22 + 3119: 10,-20 + 3120: 10,-19 + 3121: 10,-19 + 3122: 10,-18 + 3123: 10,-17 + 3124: 10,-15 + 3125: 10,-15 + 3126: 8,-15 + 3127: 4,-15 + 3128: 6,-15 + 3129: 6,-15 + 3130: 5,-15 + 3131: 5,-14 + 3132: 5,-13 + 3133: 5,-13 + 3134: 6,-14 + 3135: 6,-12 + 3136: 6,-12 + 3137: 5,-12 + 3138: 8,-12 + 3139: 8,-13 + 3140: 9,-13 + 3141: 8,-12 + 3142: 7,-12 + 3143: 9,-12 + 3144: 10,-13 + 3145: 11,-13 + 3146: 11,-12 + 3147: 11,-11 + 3148: 11,-11 + 3149: 10,-10 + 3150: 10,-9 + 3151: 10,-9 + 3152: 10,-8 + 3153: 11,-8 + 3154: 12,-9 + 3155: 12,-9 + 3156: 11,-9 + 3157: 11,-6 + 3158: 10,-6 + 3159: 10,-6 + 3160: 10,-5 + 3161: 10,-5 + 3162: 11,-6 + 3163: 11,-7 + 3164: 11,-7 + 3165: 13,-12 + 3166: 13,-11 + 3167: 14,-11 + 3168: 14,-11 + 3169: 14,-12 + 3170: 15,-12 + 3171: 15,-11 + 3734: -37,3 + 3747: -36,10 + 3760: -36,3 + 3766: -38,5 + 3767: -37,5 + 3768: -35,5 + 3769: -36,5 + 3770: -35,5 + 3808: -54,2 + 3809: -54,3 + 3810: -54,4 + 3811: -54,6 + 3812: -55,4 + 3813: -55,3 + 3814: -55,2 + 3815: -53,2 + 3816: -53,3 + 3817: -53,4 + 3818: -53,6 + 3819: -55,6 + 3827: -37,8 + 3828: -36,8 + 3829: -34,8 + 3830: -35,8 + 3833: -34,9 + 3834: -37,9 + 3835: -27,10 + 3895: -39,8 + 3896: -39,7 + 3898: -40,7 + 3899: -41,7 + 3900: -39,10 + 3901: -40,10 + 3902: -43,9 + 3903: -44,9 + 3904: -45,9 + 3905: -48,9 + 3906: -47,9 + 3910: -46,6 + 3912: -46,7 + 4205: -47,-10 + 4208: -40,-11 + 4210: -43,-10 + 4247: -53,-25 + 4263: -41,-12 + 5205: 5,27 + 5206: 6,26 + 5207: 5,25 + 5208: 6,30 + 5209: 5,29 + 5210: 4,30 + 5211: 2,30 + 5212: 9,30 + 5213: 9,29 + 5214: 6,32 + 5215: 5,33 + 5216: 4,34 + 5217: 10,32 + 5218: 9,35 + 5219: 1,32 + 5220: 2,32 + 5221: 2,35 + 5222: 1,37 + 5223: 5,38 + 5224: 7,38 + 5225: 9,37 + 5226: 5,39 + 5227: 5,41 + 5228: 3,38 + 5229: 1,38 + 5230: 0,39 + 5231: 1,41 + 5232: 1,41 + 5233: 11,36 + 5234: 11,38 + 5235: 6,39 + 5236: 6,40 + 5237: 3,37 + 5268: 4,37 + 5269: 6,37 + 5270: 6,41 + 5271: 7,41 + 5272: 7,39 + 5273: -1,37 + 5274: 1,42 + 5275: 0,41 + 5276: 1,39 + 5277: 12,37 + 5278: 12,36 + 5279: 10,34 + 5280: 10,36 + 5281: 1,34 + 5282: 1,35 + 5283: 2,34 + 5284: 9,36 - node: cleanable: True angle: 0.2617993877991494 rad color: '#FFFFFFFF' id: DirtHeavy decals: - 2161: -51,-11 - 2162: -51,-9 - 2163: -51,-9 - 2164: -52,-6 - 2165: -52,-6 - 2166: -51,-5 - 2167: -51,-6 - 2168: -51,-6 - 2169: -51,-9 - 2170: -51,-11 - 2171: -52,-10 - 2172: -53,-10 - 2173: -51,-14 - 2174: -51,-14 + 2123: -51,-11 + 2124: -51,-9 + 2125: -51,-9 + 2126: -52,-6 + 2127: -52,-6 + 2128: -51,-5 + 2129: -51,-6 + 2130: -51,-6 + 2131: -51,-9 + 2132: -51,-11 + 2133: -52,-10 + 2134: -53,-10 + 2135: -51,-14 + 2136: -51,-14 - node: angle: 1.5707963267948966 rad color: '#FFFFFFFF' id: DirtHeavy decals: - 4396: -78,-7 - 4397: -78,-6 - 4398: -78,-5 - 4399: -79,-5 - 4400: -79,-6 - 4401: -79,-7 + 4269: -78,-7 + 4270: -78,-6 + 4271: -78,-5 + 4272: -79,-5 + 4273: -79,-6 + 4274: -79,-7 - node: cleanable: True angle: 4.71238898038469 rad color: '#FFFFFFFF' id: DirtHeavy decals: - 1991: -57,-11 - 1992: -56,-11 - 1993: -56,-9 + 1953: -57,-11 + 1954: -56,-11 + 1955: -56,-9 - node: cleanable: True color: '#B18BDAFF' id: DirtHeavyMonotile decals: - 4153: -20,-66 + 4026: -20,-66 - node: color: '#F9FFFF31' id: DirtHeavyMonotile decals: - 4978: -21,-43 - 4979: -21,-44 + 4781: -21,-43 + 4782: -21,-44 - node: color: '#F9FFFF8F' id: DirtHeavyMonotile decals: - 4980: -21,-43 - 4981: -21,-44 - 4982: -22,-43 + 4783: -21,-43 + 4784: -21,-44 + 4785: -22,-43 - node: color: '#FFFFFF58' id: DirtHeavyMonotile decals: - 4243: -36,-23 - 4244: -36,-22 - 4245: -36,-21 - 4246: -36,-21 - 4247: -36,-20 - 4248: -36,-19 - 4249: -36,-18 - 4250: -36,-17 - 4251: -35,-17 - 4252: -36,-16 - 4253: -36,-15 - 4254: -36,-14 - 4255: -31,-23 - 4256: -31,-22 - 4257: -32,-22 - 4258: -32,-23 - 4259: -33,-23 - 4260: -33,-22 - 4261: -33,-21 - 4262: -32,-19 - 4263: -35,-21 - 4264: -34,-21 - 4265: -34,-20 - 4266: -34,-19 - 4267: -30,-17 - 4268: -29,-17 - 4269: -29,-17 - 4270: -27,-17 - 4271: -28,-17 - 4272: -28,-15 - 4273: -29,-15 - 4274: -30,-15 - 4275: -31,-15 - 4276: -31,-15 - 4277: -30,-15 - 4278: -30,-15 - 4279: -29,-15 - 4280: -29,-15 - 4281: -28,-15 + 4116: -36,-23 + 4117: -36,-22 + 4118: -36,-21 + 4119: -36,-21 + 4120: -36,-20 + 4121: -36,-19 + 4122: -36,-18 + 4123: -36,-17 + 4124: -35,-17 + 4125: -36,-16 + 4126: -36,-15 + 4127: -36,-14 + 4128: -31,-23 + 4129: -31,-22 + 4130: -32,-22 + 4131: -32,-23 + 4132: -33,-23 + 4133: -33,-22 + 4134: -33,-21 + 4135: -32,-19 + 4136: -35,-21 + 4137: -34,-21 + 4138: -34,-20 + 4139: -34,-19 + 4140: -30,-17 + 4141: -29,-17 + 4142: -29,-17 + 4143: -27,-17 + 4144: -28,-17 + 4145: -28,-15 + 4146: -29,-15 + 4147: -30,-15 + 4148: -31,-15 + 4149: -31,-15 + 4150: -30,-15 + 4151: -30,-15 + 4152: -29,-15 + 4153: -29,-15 + 4154: -28,-15 - node: color: '#FFFFFFFF' id: DirtHeavyMonotile decals: - 3841: -37,13 - 3842: -37,14 - 3843: -36,14 - 3844: -36,13 - 3845: -35,13 - 3846: -35,14 - 4975: -20,-42 - 4976: -21,-42 - 4977: -20,-43 + 3724: -37,13 + 3725: -37,14 + 3726: -36,14 + 3727: -36,13 + 3728: -35,13 + 3729: -35,14 + 4778: -20,-42 + 4779: -21,-42 + 4780: -20,-43 - node: cleanable: True color: '#FFFFFFFF' id: DirtHeavyMonotile decals: - 1941: -57,-9 - 2036: -61,-14 - 2037: -61,-13 - 2038: -61,-17 - 2039: -58,-17 - 2040: -57,-17 - 2041: -58,-18 - 2042: -59,-19 - 2207: -51,-17 - 2480: -46,-24 - 2552: -52,-41 - 2553: -52,-40 - 4115: -36,-7 - 4116: -35,-7 - 4117: -35,-6 - 4118: -35,-5 - 4119: -34,-5 - 4120: -33,-5 - 4121: -33,-6 - 4122: -34,-7 - 4123: -35,-8 - 4124: -36,-8 - 4125: -34,-7 - 4126: -36,-6 - 4127: -36,-5 - 4129: -36,-4 - 4130: -34,-4 - 4131: -33,-4 - 4132: -32,-4 - 4133: -31,-4 - 4134: -31,-7 - 4135: -32,-6 - 4136: -33,-7 - 4137: -31,-6 - 4139: -31,-5 - 4140: -32,-5 - 4334: -45,-11 - 4336: -39,-6 - 4361: -45,-10 - 4362: -33,-23 - 4367: -34,-1 - 4389: -47,-15 - 4747: -5,-40 - 4748: -5,-39 - 4749: -4,-39 - 4750: -4,-41 + 1903: -57,-9 + 1998: -61,-14 + 1999: -61,-13 + 2000: -61,-17 + 2001: -58,-17 + 2002: -57,-17 + 2003: -58,-18 + 2004: -59,-19 + 2169: -51,-17 + 2442: -46,-24 + 2514: -52,-41 + 2515: -52,-40 + 3992: -36,-7 + 3993: -35,-7 + 3994: -35,-6 + 3995: -35,-5 + 3996: -34,-5 + 3997: -33,-5 + 3998: -33,-6 + 3999: -34,-7 + 4000: -35,-8 + 4001: -36,-8 + 4002: -34,-7 + 4003: -36,-6 + 4004: -36,-5 + 4006: -36,-4 + 4007: -34,-4 + 4008: -33,-4 + 4009: -32,-4 + 4010: -31,-4 + 4011: -32,-6 + 4013: -32,-5 + 4207: -45,-11 + 4209: -39,-6 + 4234: -45,-10 + 4235: -33,-23 + 4240: -34,-1 + 4262: -47,-15 + 4574: -5,-40 + 4575: -5,-39 + 4576: -4,-39 + 4577: -4,-41 - node: cleanable: True color: '#B18BDAFF' id: DirtLight decals: - 4147: -11,-45 + 4020: -11,-45 - node: color: '#FFFFFF5B' id: DirtLight decals: - 1879: -70,-10 - 1880: -71,-10 - 1881: -72,-10 + 1841: -70,-10 + 1842: -71,-10 + 1843: -72,-10 - node: color: '#FFFFFF82' id: DirtLight decals: - 4339: -43,-15 - 4340: -44,-16 - 4341: -43,-16 - 4342: -43,-16 - 4343: -47,-16 - 4344: -47,-15 - 4345: -47,-15 - 4346: -47,-14 - 4347: -48,-15 - 4348: -47,-12 - 4349: -46,-12 - 4350: -47,-12 - 4351: -48,-11 - 4352: -43,-12 - 4353: -44,-12 - 4354: -44,-10 - 4355: -45,-10 - 4356: -44,-8 - 4357: -43,-7 - 4358: -43,-8 - 4359: -42,-8 - 4360: -43,-8 + 4212: -43,-15 + 4213: -44,-16 + 4214: -43,-16 + 4215: -43,-16 + 4216: -47,-16 + 4217: -47,-15 + 4218: -47,-15 + 4219: -47,-14 + 4220: -48,-15 + 4221: -47,-12 + 4222: -46,-12 + 4223: -47,-12 + 4224: -48,-11 + 4225: -43,-12 + 4226: -44,-12 + 4227: -44,-10 + 4228: -45,-10 + 4229: -44,-8 + 4230: -43,-7 + 4231: -43,-8 + 4232: -42,-8 + 4233: -43,-8 - node: cleanable: True color: '#FFFFFFFF' id: DirtLight decals: - 2481: -46,-24 - 2482: -46,-24 - 3852: -46,9 - 4333: -38,-10 - 4384: 5,22 + 2443: -46,-24 + 2444: -46,-24 + 3735: -46,9 + 4206: -38,-10 + 4257: 5,22 - node: cleanable: True color: '#FFFFFFFF' id: DirtMedium decals: - 3853: -42,9 - 3854: -41,10 - 3855: -40,9 - 3856: -41,17 - 3857: -41,18 - 3858: -28,9 - 3859: -32,9 - 3860: -39,3 - 3861: -39,3 - 3862: -39,5 - 3863: -40,3 - 3864: -47,6 - 4338: -48,-10 - 4439: -47,21 - 4440: -48,21 - 4441: -49,21 - 4442: -49,22 - 4443: -47,22 - 4444: -42,20 - 4445: -41,21 - 4446: -44,21 - 4447: -43,20 - 4448: -50,21 - 4449: -52,21 - 4450: -52,21 - 4451: -53,21 - 4452: -49,20 - 4453: -51,22 - 4454: -54,20 - 4455: -47,20 - 4456: -50,27 - 4457: -52,28 - 4458: -52,25 - 4459: -55,30 - 4460: -51,31 - 4461: -54,30 - 4462: -56,28 - 4463: -49,32 - 4464: -54,33 - 4465: -55,34 - 4466: -55,31 - 4467: -51,32 - 4468: -55,35 - 4469: -56,31 - 4470: -51,28 - 4471: -49,30 - 4472: -52,27 - 4473: -45,25 - 4474: -46,26 - 4475: -48,27 + 3736: -42,9 + 3737: -41,10 + 3738: -40,9 + 3739: -41,17 + 3740: -28,9 + 3741: -32,9 + 3742: -39,3 + 3743: -39,3 + 3744: -39,5 + 3745: -40,3 + 3746: -47,6 + 4211: -48,-10 + 4278: -47,21 + 4279: -48,21 + 4280: -49,21 + 4281: -41,21 + 4282: -50,21 + 4283: -52,21 + 4284: -52,21 + 4285: -50,27 + 4286: -52,28 + 4287: -52,25 + 4288: -55,30 + 4289: -51,31 + 4290: -54,30 + 4291: -56,28 + 4292: -49,32 + 4293: -54,33 + 4294: -55,34 + 4295: -55,31 + 4296: -51,32 + 4297: -55,35 + 4298: -56,31 + 4299: -51,28 + 4300: -49,30 + 4301: -52,27 + 4302: -45,25 + 4303: -46,26 + 4304: -48,27 + 5082: -62,24 + 5083: -62,23 + 5084: -60,23 + 5085: -60,24 + 5086: -62,25 + 5087: -59,20 + 5088: -58,22 + 5089: -61,20 + 5090: -62,22 + 5091: -56,20 + 5092: -56,22 + 5093: -58,20 + 5094: -52,20 + 5095: -53,21 + 5096: -52,22 + 5097: -50,20 + 5098: -50,22 + 5099: -54,22 + 5100: -48,20 + 5101: -49,20 + 5102: -49,20 + 5103: -51,22 + 5104: -48,22 + 5105: -47,20 + 5106: -46,21 + 5107: -43,20 + 5108: -42,21 + 5109: -44,21 + 5110: -44,20 + 5111: -41,20 + 5112: -51,21 + 5113: -54,22 + 5114: -54,20 + 5115: -64,24 + 5116: -65,26 + 5117: -65,26 + 5118: -66,25 + 5119: -66,24 + 5120: -65,24 + 5121: -65,25 + 5122: -68,26 + 5123: -69,24 + 5124: -69,25 + 5125: -67,24 + 5126: -68,25 + 5127: -73,26 + 5128: -72,26 + 5129: -71,26 + 5130: -71,25 + 5131: -73,28 + 5132: -73,30 + 5133: -76,30 + 5134: -78,30 + 5135: -78,29 + 5136: -69,29 + 5137: -69,30 + 5138: -70,30 + 5139: -68,31 + 5140: -68,32 + 5141: -70,33 + 5142: -68,34 + 5143: -68,34 + 5144: -69,35 + 5145: -72,37 + 5146: -73,37 + 5147: -72,36 + 5148: -74,36 + 5149: -74,37 + 5150: -78,35 + 5151: -77,34 + 5152: -78,32 + 5153: -77,32 + 5154: -76,32 + 5155: -77,33 + 5156: -78,33 + 5157: -77,30 + 5158: -76,30 + 5159: -78,30 + 5160: -75,30 + 5161: -73,30 + 5256: 0,37 + 5257: 0,38 + 5258: 2,36 - node: cleanable: True color: '#FFFFFFFF' id: Donk decals: - 2786: -43,-48 + 2748: -43,-48 - node: color: '#FFFFFFFF' id: FlowersBROne decals: - 4491: -71,-2 + 4319: -71,-2 - node: color: '#FFFFFFFF' id: Flowersbr1 decals: - 4486: -72,-2 - 4487: -70,-2 + 4314: -72,-2 + 4315: -70,-2 - node: color: '#FFFFFFFF' id: Flowerspv2 decals: - 4488: -71,-2 + 4316: -71,-2 - node: color: '#FFFFFFFF' id: Flowersy4 decals: - 4489: -72,-2 - 4490: -70,-2 + 4317: -72,-2 + 4318: -70,-2 - node: color: '#65090093' id: Gene decals: - 3585: -50,15 - 3586: -50,15 - 3587: -74,-1 + 3547: -50,15 + 3548: -50,15 + 3549: -74,-1 - node: cleanable: True color: '#690000C3' id: Gib decals: - 2787: -42,-53 + 2749: -42,-53 - node: angle: 3.141592653589793 rad color: '#334E6DCC' id: LoadingAreaGreyscale decals: - 775: -76,2 + 744: -76,2 + - node: + angle: 1.5707963267948966 rad + color: '#DE3A3ACC' + id: LoadingAreaGreyscale + decals: + 4921: 7,17 - node: angle: 3.141592653589793 rad color: '#FFFFFFCC' id: LoadingAreaGreyscale decals: - 772: -74,2 - 773: -68,2 - 774: -66,2 + 741: -74,2 + 742: -68,2 + 743: -66,2 - node: color: '#724276FF' id: MiniTileCheckerAOverlay decals: - 73: -11,-43 - 74: -12,-43 - 75: -12,-42 - 76: -11,-42 - 77: -11,-41 - 78: -12,-41 + 42: -11,-43 + 43: -12,-43 + 44: -12,-42 + 45: -11,-42 + 46: -11,-41 + 47: -12,-41 - node: color: '#765428FF' id: MiniTileCheckerAOverlay decals: - 42: 1,-24 - 43: 0,-24 - 44: -1,-24 - 45: -1,-23 - 46: 0,-23 - 47: 1,-23 - 48: 1,-22 - 49: 0,-22 - 50: -1,-22 + 11: 1,-24 + 12: 0,-24 + 13: -1,-24 + 14: -1,-23 + 15: 0,-23 + 16: 1,-23 + 17: 1,-22 + 18: 0,-22 + 19: -1,-22 - node: color: '#808080FF' id: MiniTileCheckerAOverlay decals: - 886: -63,-5 - 887: -62,-5 - 888: -61,-5 - 889: -60,-5 - 890: -60,-6 - 891: -61,-6 - 892: -62,-6 - 893: -63,-6 - 894: -63,-7 - 895: -62,-7 - 896: -61,-7 - 897: -60,-7 - 898: -60,-8 - 899: -61,-8 - 900: -63,-8 - 901: -62,-8 + 853: -63,-5 + 854: -62,-5 + 855: -61,-5 + 856: -60,-5 + 857: -60,-6 + 858: -61,-6 + 859: -62,-6 + 860: -63,-6 + 861: -63,-7 + 862: -62,-7 + 863: -61,-7 + 864: -60,-7 + 865: -60,-8 + 866: -61,-8 + 867: -63,-8 + 868: -62,-8 - node: - color: '#9C2020FF' - id: MiniTileCheckerBOverlay + color: '#FFFFFFCC' + id: MiniTileDarkCornerNe decals: - 3681: 11,15 + 5318: 10,18 - node: color: '#FFFFFFFF' id: MiniTileDarkCornerNe decals: - 51: 1,-22 - 82: -11,-41 + 20: 1,-22 + 51: -11,-41 - node: color: '#FFFFFFFF' id: MiniTileDarkCornerNw decals: - 81: -12,-41 + 50: -12,-41 + - node: + color: '#FFFFFFCC' + id: MiniTileDarkCornerSe + decals: + 5320: 10,16 - node: color: '#FFFFFFFF' id: MiniTileDarkCornerSe decals: - 80: -11,-43 + 49: -11,-43 - node: color: '#FFFFFFFF' id: MiniTileDarkCornerSw decals: - 79: -12,-43 + 48: -12,-43 + - node: + color: '#FFFFFFCC' + id: MiniTileDarkLineE + decals: + 5322: 10,17 - node: color: '#FFFFFFFF' id: MiniTileDarkLineE decals: - 52: 1,-23 - 53: 1,-24 - 83: -11,-42 + 21: 1,-23 + 22: 1,-24 + 52: -11,-42 + - node: + color: '#FFFFFFCC' + id: MiniTileDarkLineN + decals: + 5319: 9,18 - node: color: '#FFFFFFFF' id: MiniTileDarkLineN decals: - 60: -1,-22 - 61: 0,-22 - 62: 1,-22 + 29: -1,-22 + 30: 0,-22 + 31: 1,-22 + - node: + color: '#FFFFFFCC' + id: MiniTileDarkLineS + decals: + 5321: 9,16 - node: color: '#FFFFFFFF' id: MiniTileDarkLineS decals: - 54: 1,-24 - 55: 0,-24 - 56: -1,-24 + 23: 1,-24 + 24: 0,-24 + 25: -1,-24 - node: color: '#FFFFFFFF' id: MiniTileDarkLineW decals: - 57: -1,-24 - 58: -1,-23 - 59: -1,-22 - 84: -12,-42 + 26: -1,-24 + 27: -1,-23 + 28: -1,-22 + 53: -12,-42 - node: color: '#B3B3B3CC' id: MiniTileSteelCornerNe decals: - 1044: -41,-45 + 1011: -41,-45 - node: color: '#B3B3B3CC' id: MiniTileSteelCornerNw decals: - 1045: -45,-45 + 1012: -45,-45 - node: color: '#B3B3B3CC' id: MiniTileSteelCornerSe decals: - 1047: -41,-47 + 1014: -41,-47 - node: color: '#B3B3B3CC' id: MiniTileSteelCornerSw decals: - 1046: -45,-47 + 1013: -45,-47 - node: color: '#B3B3B3CC' id: MiniTileSteelEndE decals: - 1031: -41,-38 + 998: -41,-38 - node: color: '#B3B3B3CC' id: MiniTileSteelEndW decals: - 1032: -45,-38 + 999: -45,-38 - node: color: '#B3B3B3CC' id: MiniTileSteelInnerNe decals: - 1043: -43,-45 + 1010: -43,-45 - node: color: '#B3B3B3CC' id: MiniTileSteelInnerNw decals: - 1042: -43,-45 + 1009: -43,-45 - node: color: '#B3B3B3CC' id: MiniTileSteelInnerSe decals: - 1039: -43,-38 + 1006: -43,-38 - node: color: '#B3B3B3CC' id: MiniTileSteelInnerSw decals: - 1038: -43,-38 + 1005: -43,-38 - node: color: '#B3B3B3CC' id: MiniTileSteelLineE decals: - 1025: -43,-44 - 1026: -43,-43 - 1027: -43,-42 - 1028: -43,-41 - 1029: -43,-40 - 1030: -43,-39 - 1048: -41,-46 + 992: -43,-44 + 993: -43,-43 + 994: -43,-42 + 995: -43,-41 + 996: -43,-40 + 997: -43,-39 + 1015: -41,-46 - node: color: '#B3B3B3CC' id: MiniTileSteelLineN decals: - 1033: -44,-38 - 1034: -43,-38 - 1035: -42,-38 - 1040: -44,-45 - 1041: -42,-45 + 1000: -44,-38 + 1001: -43,-38 + 1002: -42,-38 + 1007: -44,-45 + 1008: -42,-45 - node: color: '#B3B3B3CC' id: MiniTileSteelLineS decals: - 1036: -44,-38 - 1037: -42,-38 + 1003: -44,-38 + 1004: -42,-38 - node: color: '#B3B3B3CC' id: MiniTileSteelLineW decals: - 1019: -43,-39 - 1020: -43,-40 - 1021: -43,-41 - 1022: -43,-42 - 1023: -43,-43 - 1024: -43,-44 - 1049: -45,-46 + 986: -43,-39 + 987: -43,-40 + 988: -43,-41 + 989: -43,-42 + 990: -43,-43 + 991: -43,-44 + 1016: -45,-46 - node: color: '#999999CC' id: MiniTileWhiteCornerNe decals: - 3271: -11,-16 - 3306: 7,-17 + 3233: -11,-16 + 3268: 7,-17 - node: color: '#999999CC' id: MiniTileWhiteCornerNw decals: - 3262: -12,-13 - 3265: -9,-15 - 3266: -8,-14 - 3272: -12,-16 - 3309: 5,-17 + 3224: -12,-13 + 3227: -9,-15 + 3228: -8,-14 + 3234: -12,-16 + 3271: 5,-17 - node: color: '#999999CC' id: MiniTileWhiteCornerSe decals: - 3260: -8,-12 - 3261: -11,-14 - 3267: -12,-11 - 3268: -11,-10 - 3307: 7,-19 + 3222: -8,-12 + 3223: -11,-14 + 3229: -12,-11 + 3230: -11,-10 + 3269: 7,-19 - node: color: '#999999CC' id: MiniTileWhiteCornerSw decals: - 3308: 5,-19 + 3270: 5,-19 - node: color: '#999999CC' id: MiniTileWhiteLineE decals: - 3270: -11,-9 - 3311: 7,-18 + 3232: -11,-9 + 3273: 7,-18 - node: color: '#999999CC' id: MiniTileWhiteLineN decals: - 3263: -7,-14 - 3305: 6,-17 - 3313: -9,-9 - 3314: -8,-9 - 3315: -10,-9 - 3316: -7,-9 + 3225: -7,-14 + 3267: 6,-17 + 3275: -9,-9 + 3276: -8,-9 + 3277: -10,-9 + 3278: -7,-9 - node: color: '#999999CC' id: MiniTileWhiteLineS decals: - 3269: -13,-11 - 3310: 6,-19 + 3231: -13,-11 + 3272: 6,-19 - node: color: '#999999CC' id: MiniTileWhiteLineW decals: - 3264: -9,-16 - 3312: 5,-18 + 3226: -9,-16 + 3274: 5,-18 - node: cleanable: True color: '#4E00008B' id: Newton decals: - 2486: -50,-41 + 2448: -50,-41 - node: color: '#6B000079' id: Osiron decals: - 3459: 9,23 - 3460: 9,23 + 3421: 9,23 + 3422: 9,23 - node: cleanable: True angle: 0.2617993877991494 rad color: '#5200006B' id: Psyke decals: - 2118: -58,-17 + 2080: -58,-17 - node: color: '#6B000079' id: Psyke decals: - 3457: 12,12 - 3458: 12,12 + 3419: 12,12 + 3420: 12,12 - node: color: '#446326CC' id: QuarterTileOverlayGreyscale decals: - 3001: -22,-4 - 3004: -21,-5 - 3005: -22,-5 - 3006: -22,-6 - 3007: -21,-6 - 3094: -20,-6 - 3097: -20,-5 - 3098: -20,-7 - 3099: -20,-8 - 3100: -20,-9 - 3101: -21,-10 - 3102: -20,-10 - 3103: -20,-11 - 3104: -20,-12 - 3105: -19,-12 - 3127: -19,-5 - 3128: -19,-6 - 3129: -19,-7 - 3130: -19,-8 + 2963: -22,-4 + 2966: -21,-5 + 2967: -22,-5 + 2968: -22,-6 + 2969: -21,-6 + 3056: -20,-6 + 3059: -20,-5 + 3060: -20,-7 + 3061: -20,-8 + 3062: -20,-9 + 3063: -21,-10 + 3064: -20,-10 + 3065: -20,-11 + 3066: -20,-12 + 3067: -19,-12 + 3089: -19,-5 + 3090: -19,-6 + 3091: -19,-7 + 3092: -19,-8 - node: color: '#446326CC' id: QuarterTileOverlayGreyscale180 decals: - 3002: -22,-4 - 3003: -21,-5 - 3008: -22,-5 - 3009: -22,-6 - 3010: -21,-6 - 3084: -20,-6 - 3085: -20,-8 - 3086: -20,-9 - 3087: -20,-10 - 3088: -20,-11 - 3089: -20,-12 - 3090: -19,-12 - 3091: -21,-10 - 3092: -20,-5 - 3106: -20,-7 - 3123: -19,-8 - 3124: -19,-7 - 3125: -19,-6 - 3126: -19,-5 + 2964: -22,-4 + 2965: -21,-5 + 2970: -22,-5 + 2971: -22,-6 + 2972: -21,-6 + 3046: -20,-6 + 3047: -20,-8 + 3048: -20,-9 + 3049: -20,-10 + 3050: -20,-11 + 3051: -20,-12 + 3052: -19,-12 + 3053: -21,-10 + 3054: -20,-5 + 3068: -20,-7 + 3085: -19,-8 + 3086: -19,-7 + 3087: -19,-6 + 3088: -19,-5 - node: color: '#FFFFFFFF' id: Remains decals: - 3456: 18,8 + 3418: 18,8 - node: color: '#FFFFFFFF' id: Rock06 decals: - 1319: -25.224575,23.196384 - 1330: -37.434036,18.932444 - 1338: 12,-23 - 1354: -17,-75 - 1356: -19,-60 - 1357: -20,-69 - 1373: -44,41 - 1380: -79,-13 + 1286: -25.224575,23.196384 + 1297: -37.434036,18.932444 + 1303: 12,-23 + 1319: -17,-75 + 1321: -19,-60 + 1322: -20,-69 + 1338: -44,41 + 1344: -79,-13 - node: color: '#FFFFFFFF' id: Rock07 decals: - 1339: 14,-20 - 1355: -12,-76 - 1381: -73,-21 - 1382: -69,-18 + 1304: 14,-20 + 1320: -12,-76 + 1345: -73,-21 + 1346: -69,-18 - node: cleanable: True color: '#48000063' id: Sirius decals: - 2941: -12,-50 + 2903: -12,-50 - node: color: '#FFFFFFFF' id: SpaceStationSign1 decals: - 791: 4,-1 + 760: 4,-1 - node: color: '#FFFFFFFF' id: SpaceStationSign2 decals: - 792: 5,-1 + 761: 5,-1 - node: color: '#FFFFFFFF' id: SpaceStationSign3 decals: - 793: 6,-1 + 762: 6,-1 - node: color: '#FFFFFFFF' id: SpaceStationSign4 decals: - 796: 7,-1 + 765: 7,-1 - node: color: '#FFFFFFFF' id: SpaceStationSign5 decals: - 797: 8,-1 + 766: 8,-1 - node: color: '#FFFFFFFF' id: SpaceStationSign6 decals: - 798: 9,-1 + 767: 9,-1 - node: color: '#FFFFFFFF' id: SpaceStationSign7 decals: - 800: 10,-1 + 769: 10,-1 - node: cleanable: True color: '#52000089' id: Tunnel decals: - 2016: -54,-9 + 1978: -54,-9 - node: color: '#334E6DCC' id: WarnCornerGreyscaleNE decals: - 751: -76,0 - 1271: -90,-34 - 5044: -9,15 + 720: -76,0 + 1238: -90,-34 + 4847: -9,15 - node: color: '#52B4E9CC' id: WarnCornerGreyscaleNE decals: - 4112: -38,-10 - 4145: -27,-15 - 4507: 1,7 + 3991: -38,-10 + 4018: -27,-15 + 4335: 1,7 - node: color: '#9FED58CC' id: WarnCornerGreyscaleNE decals: - 4873: 19,16 + 4695: 19,16 - node: color: '#B3B3B3CC' id: WarnCornerGreyscaleNE decals: - 450: -1,19 - 1086: -7,-22 + 419: -1,19 + 1053: -7,-22 - node: color: '#BC863FCC' id: WarnCornerGreyscaleNE decals: - 1517: 10,-25 - 4815: 5,-30 + 1481: 10,-25 + 4637: 5,-30 - node: color: '#DE3A3ACC' id: WarnCornerGreyscaleNE decals: - 111: 1,4 - 3694: 6,27 - 3700: 6,20 - 3703: 8,7 + 80: 1,4 + 3586: 6,27 + 3592: 6,20 + 3595: 8,7 + - node: + color: '#EFB34196' + id: WarnCornerGreyscaleNE + decals: + 5043: -56,22 - node: color: '#EFB34199' id: WarnCornerGreyscaleNE decals: - 3970: -37,1 - 4058: -34,5 + 3852: -37,1 + 3939: -34,5 - node: color: '#F98AFFCC' id: WarnCornerGreyscaleNE decals: - 4179: -11,-45 - 4183: -14,-49 - 4929: -15,-52 - 4963: -15,-63 + 4052: -11,-45 + 4056: -14,-49 + 4732: -15,-52 + 4766: -15,-63 - node: color: '#334E6DCC' id: WarnCornerGreyscaleNW decals: - 5045: -19,15 - 5052: -13,5 + 4848: -19,15 + 4855: -13,5 - node: cleanable: True color: '#52B4E996' id: WarnCornerGreyscaleNW decals: - 4101: -36,-10 - 4102: -36,-10 + 3980: -36,-10 + 3981: -36,-10 - node: color: '#52B4E9CC' id: WarnCornerGreyscaleNW decals: - 1409: -33,-9 - 4144: -29,-8 + 1373: -33,-9 + 4017: -29,-8 - node: color: '#9FED58CC' id: WarnCornerGreyscaleNW decals: - 662: -53,-20 + 631: -53,-20 - node: color: '#B3B3B3CC' id: WarnCornerGreyscaleNW decals: - 306: 12,1 - 2484: -51,1 + 275: 12,1 + 2446: -51,1 - node: color: '#BC863FCC' id: WarnCornerGreyscaleNW decals: - 4805: 2,-30 - 4812: 2,-26 - 4813: 3,-24 - 4997: -7,-38 + 4627: 2,-30 + 4634: 2,-26 + 4635: 3,-24 + 4800: -7,-38 - node: color: '#DE3A3ACC' id: WarnCornerGreyscaleNW decals: - 3699: 5,20 - 4523: 5,27 + 3591: 5,20 + 4350: 5,27 + - node: + color: '#EFB34196' + id: WarnCornerGreyscaleNW + decals: + 5061: -54,22 - node: color: '#EFB34199' id: WarnCornerGreyscaleNW decals: - 3969: -38,1 + 3851: -38,1 - node: color: '#F98AFFCC' id: WarnCornerGreyscaleNW decals: - 4182: -17,-49 - 4928: -16,-52 - 4950: -17,-45 - 4953: -9,-70 + 4055: -17,-49 + 4731: -16,-52 + 4753: -17,-45 + 4756: -9,-70 - node: color: '#334E6DCC' id: WarnCornerGreyscaleSE decals: - 4947: -10,3 - 5043: -9,14 - 5089: -17,9 + 4750: -10,3 + 4846: -9,14 + 4892: -17,9 - node: color: '#52B4E9CC' id: WarnCornerGreyscaleSE decals: - 4108: -38,-12 - 4143: -27,-13 + 3987: -38,-12 + 4016: -27,-13 - node: color: '#9FED58CC' id: WarnCornerGreyscaleSE decals: - 4522: 16,-5 + 4349: 16,-5 - node: color: '#B3B3B3CC' id: WarnCornerGreyscaleSE decals: - 780: -51,-3 - 1087: -7,-27 - 3317: -2,-20 + 749: -51,-3 + 1054: -7,-27 + 3279: -2,-20 - node: color: '#BC863FCC' id: WarnCornerGreyscaleSE decals: - 1518: 10,-29 - 4996: -2,-39 + 1482: 10,-29 + 4799: -2,-39 - node: color: '#DE3A3ACC' id: WarnCornerGreyscaleSE decals: - 3688: 7,22 - 4392: -27,-22 - 4493: 6,25 - 4494: 8,6 - 4524: 1,-6 + 3580: 7,22 + 4265: -27,-22 + 4321: 6,25 + 4322: 8,6 + 4351: 1,-6 + - node: + color: '#EFB34196' + id: WarnCornerGreyscaleSE + decals: + 4958: -68,29 + 4959: -76,29 + 4960: -75,30 + 5044: -56,20 - node: color: '#EFB34199' id: WarnCornerGreyscaleSE decals: - 3972: -46,3 - 3995: -40,17 - 3996: -39,7 + 3854: -46,3 + 3876: -40,17 + 3877: -39,7 - node: color: '#F98AFFCC' id: WarnCornerGreyscaleSE decals: - 586: -17,-39 - 4163: -24,-44 - 4930: -15,-54 - 4951: -8,-68 + 555: -17,-39 + 4036: -24,-44 + 4733: -15,-54 + 4754: -8,-68 - node: - color: '#FA750096' + color: '#FA7500CC' id: WarnCornerGreyscaleSE decals: - 4096: -31,-7 + 4929: -31,-7 - node: color: '#334E6DCC' id: WarnCornerGreyscaleSW decals: - 5046: -19,14 + 4849: -19,14 - node: color: '#52B4E9CC' id: WarnCornerGreyscaleSW decals: - 171: -29,-6 - 3740: -44,-8 - 4109: -36,-12 - 4148: -31,-17 - 4375: -49,-12 + 140: -29,-6 + 3627: -44,-8 + 3988: -36,-12 + 4021: -31,-17 + 4248: -49,-12 - node: color: '#9FED58CC' id: WarnCornerGreyscaleSW decals: - 217: -16,-3 - 4874: 16,13 + 186: -16,-3 + 4696: 16,13 - node: color: '#B3B3B3CC' id: WarnCornerGreyscaleSW decals: - 331: 10,-3 - 587: -34,-37 + 300: 10,-3 + 556: -34,-37 - node: color: '#BC863FCC' id: WarnCornerGreyscaleSW decals: - 4994: -4,-45 + 4797: -4,-45 - node: color: '#DE3A3ACC' id: WarnCornerGreyscaleSW decals: - 3687: 4,22 - 3695: 5,25 - 3712: -30,-20 - 4495: 5,2 + 3579: 4,22 + 3587: 5,25 + 3599: -30,-20 + 4323: 5,2 + - node: + color: '#EFB34196' + id: WarnCornerGreyscaleSW + decals: + 4954: -70,29 + 4957: -78,29 + 4961: -71,30 + 5060: -54,20 - node: color: '#EFB34199' id: WarnCornerGreyscaleSW decals: - 3994: -42,17 - 4036: -32,9 - 4053: -40,3 + 3875: -42,17 + 3917: -32,9 + 3934: -40,3 - node: color: '#F98AFFCC' id: WarnCornerGreyscaleSW decals: - 4190: -17,-69 - 4932: -16,-54 - 4954: -9,-72 + 4063: -17,-69 + 4735: -16,-54 + 4757: -9,-72 - node: color: '#334E6DCC' id: WarnCornerSmallGreyscaleNE decals: - 1206: -63,-34 - 1270: -91,-34 + 1173: -63,-34 + 1237: -91,-34 - node: color: '#B3B3B3CC' id: WarnCornerSmallGreyscaleNE decals: - 988: -56,-21 + 955: -56,-21 - node: color: '#F98AFFCC' id: WarnCornerSmallGreyscaleNE decals: - 4973: -15,-67 + 4776: -15,-67 - node: color: '#334E6DCC' id: WarnCornerSmallGreyscaleNW decals: - 1297: -94,-36 + 1264: -94,-36 - node: color: '#B3B3B3CC' id: WarnCornerSmallGreyscaleNW decals: - 329: 12,0 - 2485: -51,0 + 298: 12,0 + 2447: -51,0 - node: color: '#BC863FCC' id: WarnCornerSmallGreyscaleNW decals: - 1267: -91,-33 + 1234: -91,-33 - node: color: '#DE3A3ACC' id: WarnCornerSmallGreyscaleNW decals: - 1202: -63,-34 + 1169: -63,-34 - node: color: '#F98AFFCC' id: WarnCornerSmallGreyscaleNW decals: - 4974: -12,-67 + 4777: -12,-67 - node: color: '#52B4E9CC' id: WarnCornerSmallGreyscaleSE decals: - 1198: -63,-36 + 1165: -63,-36 - node: color: '#9FED58CC' id: WarnCornerSmallGreyscaleSE decals: - 1269: -91,-36 + 1236: -91,-36 - node: color: '#B3B3B3CC' id: WarnCornerSmallGreyscaleSE decals: - 500: -3,-20 - 781: -51,-2 - 989: -56,-21 + 469: -3,-20 + 750: -51,-2 + 956: -56,-21 + - node: + color: '#EFB34196' + id: WarnCornerSmallGreyscaleSE + decals: + 4963: -76,30 - node: color: '#334E6DCC' id: WarnCornerSmallGreyscaleSW decals: - 1298: -94,-34 + 1265: -94,-34 - node: color: '#B3B3B3CC' id: WarnCornerSmallGreyscaleSW decals: - 330: 10,-2 - 588: -34,-36 + 299: 10,-2 + 557: -34,-36 - node: color: '#DE3A3ACC' id: WarnCornerSmallGreyscaleSW decals: - 1263: -91,-37 - 3713: -29,-20 + 1230: -91,-37 + 3600: -29,-20 + - node: + color: '#EFB34196' + id: WarnCornerSmallGreyscaleSW + decals: + 4962: -70,30 - node: color: '#F98AFFCC' id: WarnCornerSmallGreyscaleSW decals: - 1195: -63,-36 + 1162: -63,-36 - node: color: '#334E6DCC' id: WarnEndGreyscaleE decals: - 5005: -27,14 + 4808: -27,14 - node: color: '#B3B3B3CC' id: WarnEndGreyscaleE decals: - 985: -55,-21 + 952: -55,-21 + - node: + color: '#DE3A3ACC' + id: WarnEndGreyscaleE + decals: + 5200: 2,32 + 5201: 10,32 + 5305: 1,10 - node: color: '#334E6DCC' id: WarnEndGreyscaleN decals: - 5047: -22,15 - 5050: -6,15 + 4850: -22,15 + 4853: -6,15 - node: color: '#B3B3B3CC' id: WarnEndGreyscaleN decals: - 428: 34,19 - 987: -56,-20 + 397: 34,19 + 954: -56,-20 - node: color: '#DE3A3ACC' id: WarnEndGreyscaleN decals: - 3702: 3,4 + 3594: 3,4 - node: color: '#F98AFFCC' id: WarnEndGreyscaleN decals: - 4948: -17,-41 + 4751: -17,-41 - node: color: '#334E6DCC' id: WarnEndGreyscaleS decals: - 5048: -22,14 - 5049: -6,14 + 4851: -22,14 + 4852: -6,14 - node: color: '#B3B3B3CC' id: WarnEndGreyscaleS decals: - 986: -56,-22 + 953: -56,-22 - node: color: '#DE3A3ACC' id: WarnEndGreyscaleS decals: - 3701: 3,2 + 3593: 3,2 - node: color: '#F98AFFCC' id: WarnEndGreyscaleS decals: - 4949: -17,-43 + 4752: -17,-43 - node: color: '#334E6DCC' id: WarnEndGreyscaleW decals: - 5004: -28,14 + 4807: -28,14 - node: color: '#DE3A3ACC' id: WarnEndGreyscaleW decals: - 4481: 8,3 + 4310: 8,3 + 5198: 1,32 + 5199: 9,32 + 5304: 0,10 - node: color: '#334E6DCC' id: WarnFullGreyscale decals: - 1204: -62,-33 - 1228: -62,-35 - 1229: -63,-35 - 1230: -64,-35 - 1231: -65,-35 - 1232: -66,-33 - 1233: -66,-32 - 1234: -65,-32 - 1237: -66,-38 - 1238: -66,-37 - 1246: -90,-33 - 1288: -92,-35 - 1293: -95,-36 - 1294: -95,-34 - 1295: -95,-35 - 1386: -27,13 - 1646: -16,20 - 1647: -12,20 - 4943: -13,4 - 4944: -13,3 - 4945: -12,3 - 4946: -11,3 - 5002: -28,15 - 5003: -27,15 - 5019: -20,19 - 5020: -19,19 - 5021: -16,21 - 5022: -15,21 - 5023: -14,21 - 5024: -13,21 - 5025: -12,21 - 5026: -9,19 - 5027: -8,19 - 5029: -20,17 - 5030: -20,18 - 5065: -11,10 - 5066: -11,9 - 5067: -10,9 - 5068: -10,10 - 5069: -9,10 - 5114: -13,9 - 5115: -13,10 - - node: - color: '#3EB38896' - id: WarnFullGreyscale - decals: - 4414: -42,22 - 4415: -41,22 - 4416: -40,22 - 4417: -40,21 - 4418: -44,19 + 1171: -62,-33 + 1195: -62,-35 + 1196: -63,-35 + 1197: -64,-35 + 1198: -65,-35 + 1199: -66,-33 + 1200: -66,-32 + 1201: -65,-32 + 1204: -66,-38 + 1205: -66,-37 + 1213: -90,-33 + 1255: -92,-35 + 1260: -95,-36 + 1261: -95,-34 + 1262: -95,-35 + 1350: -27,13 + 1609: -16,20 + 1610: -12,20 + 4746: -13,4 + 4747: -13,3 + 4748: -12,3 + 4749: -11,3 + 4805: -28,15 + 4806: -27,15 + 4822: -20,19 + 4823: -19,19 + 4824: -16,21 + 4825: -15,21 + 4826: -14,21 + 4827: -13,21 + 4828: -12,21 + 4829: -9,19 + 4830: -8,19 + 4832: -20,17 + 4833: -20,18 + 4868: -11,10 + 4869: -11,9 + 4870: -10,9 + 4871: -10,10 + 4872: -9,10 + 4917: -13,9 + 4918: -13,10 - node: color: '#446326CC' id: WarnFullGreyscale decals: - 3107: -18,-6 - 3108: -18,-5 - 3109: -18,-4 - 3110: -21,-12 - 3111: -21,-7 - 3112: -21,-8 - 3113: -21,-9 - 3114: -19,-9 - 3115: -19,-10 - 3116: -19,-11 - 3117: -21,-11 - 3118: -21,-4 - 3119: -20,-4 - 3120: -19,-4 - 3121: -18,-8 - 3122: -18,-7 + 3069: -18,-6 + 3070: -18,-5 + 3071: -18,-4 + 3072: -21,-12 + 3073: -21,-7 + 3074: -21,-8 + 3075: -21,-9 + 3076: -19,-9 + 3077: -19,-10 + 3078: -19,-11 + 3079: -21,-11 + 3080: -21,-4 + 3081: -20,-4 + 3082: -19,-4 + 3083: -18,-8 + 3084: -18,-7 - node: color: '#52B4E996' id: WarnFullGreyscale decals: - 5035: -11,21 - 5036: -10,21 + 4838: -11,21 + 4839: -10,21 - node: color: '#52B4E9CC' id: WarnFullGreyscale decals: - 1196: -62,-37 - 1249: -90,-32 - 1406: -27,-11 - 1407: -28,-11 - 1408: -29,-11 - 1410: -29,-12 - 1424: -42,-15 - 1425: -42,-14 - 1426: -44,-14 - 1427: -44,-15 - 1453: -46,-14 - 1454: -46,-16 - 1455: -46,-16 - 1463: -48,-14 - 1464: -48,-16 - 3718: -31,-23 - 3719: -31,-22 - 3720: -36,-15 - 3721: -36,-17 - 3722: -36,-16 - 3723: -35,-17 - 3725: -40,-17 - 3726: -40,-16 - 3736: -43,-17 - 3737: -49,-10 - 3738: -32,-19 - 3742: -42,-8 - 4070: -43,-4 - 4071: -40,-7 - 4072: -40,-8 - 4073: -38,-7 - 4074: -38,-8 - 4082: -28,-17 - 4083: -29,-17 - 4084: -30,-15 - 4198: -36,-21 - 4199: -36,-20 - 4200: -36,-19 - 4201: -36,-18 - 4202: -36,-23 - 4371: -40,-4 - 4372: -39,-4 - 4373: -38,-4 - 4378: -47,-8 - 4379: -46,-8 - 4385: -38,-17 - 4386: -38,-16 - 4387: -38,-15 - 4388: -38,-14 - 4508: 1,6 + 1163: -62,-37 + 1216: -90,-32 + 1370: -27,-11 + 1371: -28,-11 + 1372: -29,-11 + 1374: -29,-12 + 1388: -42,-15 + 1389: -42,-14 + 1390: -44,-14 + 1391: -44,-15 + 1417: -46,-14 + 1418: -46,-16 + 1419: -46,-16 + 1427: -48,-14 + 1428: -48,-16 + 3605: -31,-23 + 3606: -31,-22 + 3607: -36,-15 + 3608: -36,-17 + 3609: -36,-16 + 3610: -35,-17 + 3612: -40,-17 + 3613: -40,-16 + 3623: -43,-17 + 3624: -49,-10 + 3625: -32,-19 + 3629: -42,-8 + 3951: -43,-4 + 3952: -40,-7 + 3953: -40,-8 + 3954: -38,-7 + 3955: -38,-8 + 3963: -28,-17 + 3964: -29,-17 + 3965: -30,-15 + 4071: -36,-21 + 4072: -36,-20 + 4073: -36,-19 + 4074: -36,-18 + 4075: -36,-23 + 4244: -40,-4 + 4245: -39,-4 + 4246: -38,-4 + 4251: -47,-8 + 4252: -46,-8 + 4258: -38,-17 + 4259: -38,-16 + 4260: -38,-15 + 4261: -38,-14 + 4336: 1,6 - node: color: '#639137CC' id: WarnFullGreyscale decals: - 1186: -64,-38 - 1258: -93,-38 + 1153: -64,-38 + 1225: -93,-38 - node: color: '#999999CC' id: WarnFullGreyscale decals: - 3273: -11,-4 + 3235: -11,-4 - node: color: '#9FED58CC' id: WarnFullGreyscale decals: - 1189: -62,-38 - 1255: -90,-37 - 4514: 13,-7 - 4515: 14,-7 - 4516: 15,-7 - 4517: 13,-4 - 4870: 17,16 - 4871: 18,13 - 4872: 19,14 - 4878: 16,15 + 1156: -62,-38 + 1222: -90,-37 + 4341: 13,-7 + 4342: 14,-7 + 4343: 15,-7 + 4344: 13,-4 + 4692: 17,16 + 4693: 18,13 + 4694: 19,14 + 4700: 16,15 - node: color: '#B3B3B3CC' id: WarnFullGreyscale decals: - 174: -7,1 - 175: -8,1 - 176: -19,1 - 177: -20,1 - 178: -21,1 - 183: -24,19 - 184: -23,19 - 185: -22,19 - 186: -22,18 - 304: 14,1 - 305: 13,1 - 315: 15,1 - 591: -29,-37 - 592: -30,-37 - 593: -31,-37 - 594: -33,-37 - 595: -32,-37 - 607: -13,-37 - 608: -12,-37 - 609: -10,-37 - 610: -10,-37 - 611: -11,-37 - 612: -9,-37 - 694: -50,1 - 724: -66,-4 - 725: -66,-3 - 1089: -10,-20 - 1139: -16,-29 - 1140: -17,-29 - 1141: -18,-30 - 1174: -8,-28 - 1175: -7,-28 - 1176: -7,-21 - 1177: -8,-21 - 3589: -16,-16 - 3590: -17,-16 - 3591: -18,-16 - 3592: -19,-16 - 3593: -20,-16 - 3594: -21,-16 - 3595: -18,-14 - 4881: 7,-20 - 4882: 8,-20 - 4883: 8,-19 - 4884: 8,-18 - 4885: 8,-17 - 4936: 1,-10 - 4937: 0,-10 - 4938: -1,-10 + 143: -7,1 + 144: -8,1 + 145: -19,1 + 146: -20,1 + 147: -21,1 + 152: -24,19 + 153: -23,19 + 154: -22,19 + 155: -22,18 + 273: 14,1 + 274: 13,1 + 284: 15,1 + 560: -29,-37 + 561: -30,-37 + 562: -31,-37 + 563: -33,-37 + 564: -32,-37 + 576: -13,-37 + 577: -12,-37 + 578: -10,-37 + 579: -10,-37 + 580: -11,-37 + 581: -9,-37 + 663: -50,1 + 693: -66,-4 + 694: -66,-3 + 1056: -10,-20 + 1106: -16,-29 + 1107: -17,-29 + 1108: -18,-30 + 1141: -8,-28 + 1142: -7,-28 + 1143: -7,-21 + 1144: -8,-21 + 3551: -16,-16 + 3552: -17,-16 + 3553: -18,-16 + 3554: -19,-16 + 3555: -20,-16 + 3556: -21,-16 + 3557: -18,-14 + 4703: 7,-20 + 4704: 8,-20 + 4705: 8,-19 + 4706: 8,-18 + 4707: 8,-17 + 4739: 1,-10 + 4740: 0,-10 + 4741: -1,-10 - node: color: '#BC863FCC' id: WarnFullGreyscale decals: - 1211: -62,-32 - 1244: -92,-32 - 4806: 2,-33 - 4807: 3,-33 - 4808: 7,-29 - 4809: 10,-27 - 4810: 2,-28 - 4811: 3,-28 - 4817: 3,-30 - 4983: -3,-45 - 4984: -7,-44 - 4985: -7,-42 - 4986: -7,-40 - 4987: -7,-41 - 4988: -6,-38 - 4989: -5,-42 + 1178: -62,-32 + 1211: -92,-32 + 4628: 2,-33 + 4629: 3,-33 + 4630: 7,-29 + 4631: 10,-27 + 4632: 2,-28 + 4633: 3,-28 + 4639: 3,-30 + 4786: -3,-45 + 4787: -7,-44 + 4788: -7,-42 + 4789: -7,-40 + 4790: -7,-41 + 4791: -6,-38 + 4792: -5,-42 - node: color: '#D69949FF' id: WarnFullGreyscale decals: - 32: 10,-31 - 33: 10,-32 - 34: 10,-33 - 35: 10,-34 - 36: 7,-34 - 37: 7,-33 - 38: 7,-32 - 39: 7,-31 + 1: 10,-31 + 2: 10,-32 + 3: 10,-33 + 4: 10,-34 + 5: 7,-34 + 6: 7,-33 + 7: 7,-32 + 8: 7,-31 - node: color: '#DE3A3A96' id: WarnFullGreyscale decals: - 5033: -8,18 - 5034: -8,17 + 4836: -8,18 + 4837: -8,17 + - node: + angle: 1.5707963267948966 rad + color: '#DE3A3A96' + id: WarnFullGreyscale + decals: + 4923: 11,16 + 4924: 11,17 + 4925: 11,18 - node: color: '#DE3A3ACC' id: WarnFullGreyscale decals: - 949: -57,-42 - 1008: 3,-10 - 1009: 3,-9 - 1010: 1,-4 - 1200: -64,-33 - 1264: -92,-38 - 1470: -26,-19 - 1471: -26,-20 - 1477: 8,4 - 3621: 5,11 - 3622: 5,12 - 3637: 7,12 - 3639: 7,11 - 3653: 9,11 - 3656: 9,12 - 3704: 5,9 - 3705: 5,8 - 3714: -29,-19 - 3715: -30,-19 - 3716: -27,-21 - 3717: -27,-19 - 4903: 10,18 - 4904: 10,17 - 4905: 10,16 - 4920: 1,20 - 4921: 1,19 - 4922: 2,19 + 916: -57,-42 + 975: 3,-10 + 976: 3,-9 + 977: 1,-4 + 1167: -64,-33 + 1231: -92,-38 + 1434: -26,-19 + 1435: -26,-20 + 1441: 8,4 + 3560: 5,11 + 3561: 5,12 + 3563: 7,12 + 3564: 7,11 + 3566: 9,11 + 3567: 9,12 + 3596: 5,9 + 3597: 5,8 + 3601: -29,-19 + 3602: -30,-19 + 3603: -27,-21 + 3604: -27,-19 + 4723: 1,20 + 4724: 1,19 + 4725: 2,19 + 5167: 5,35 + 5168: 6,35 + 5169: 7,35 + 5170: 7,34 + 5171: 7,33 + 5172: 7,32 + 5184: 3,29 + 5185: 8,29 + 5312: 0,15 + 5313: 0,14 - node: color: '#DE3A3AFF' id: WarnFullGreyscale decals: - 4886: -60,-38 - 4887: -59,-42 - 4888: -60,-42 + 4708: -59,-42 + 4709: -60,-42 - node: color: '#EFB34196' id: WarnFullGreyscale decals: - 5031: -18,21 - 5032: -17,21 + 4834: -18,21 + 4835: -17,21 + 4933: -68,28 + 4934: -69,28 + 4974: -69,31 + 4975: -77,31 + 4995: -73,33 + 4996: -73,34 + 4997: -73,32 + 5002: -74,24 + 5003: -72,24 + 5004: -73,24 + 5005: -74,25 + 5006: -74,26 + 5052: -46,22 + 5053: -47,22 + 5054: -40,21 + 5055: -40,21 + 5056: -40,22 + 5057: -41,22 + 5058: -42,22 + 5059: -44,19 - node: color: '#EFB34199' id: WarnFullGreyscale decals: - 3868: -42,6 - 3869: -43,6 - 3876: -34,3 - 3877: -35,3 - 3879: -35,5 - 3880: -36,5 - 3881: -37,5 - 3882: -38,5 - 3883: -40,4 - 3895: -48,13 - 3899: -38,15 - 3900: -34,15 - 3901: -42,13 - 3902: -42,12 - 3903: -40,13 - 3904: -40,12 - 3912: -44,4 - 3913: -42,4 - 3916: -53,2 - 3917: -53,3 - 3918: -53,4 - 3919: -55,4 - 3920: -55,3 - 3921: -55,2 - 3922: -53,6 - 3923: -55,6 - 3924: -46,2 - 3925: -48,2 - 3938: -37,7 - 3939: -36,7 - 3940: -35,7 - 3941: -34,7 - 4067: -31,5 + 3750: -42,6 + 3751: -43,6 + 3758: -34,3 + 3759: -35,3 + 3761: -35,5 + 3762: -36,5 + 3763: -37,5 + 3764: -38,5 + 3765: -40,4 + 3777: -48,13 + 3781: -38,15 + 3782: -34,15 + 3783: -42,13 + 3784: -42,12 + 3785: -40,13 + 3786: -40,12 + 3794: -44,4 + 3795: -42,4 + 3798: -53,2 + 3799: -53,3 + 3800: -53,4 + 3801: -55,4 + 3802: -55,3 + 3803: -55,2 + 3804: -53,6 + 3805: -55,6 + 3806: -46,2 + 3807: -48,2 + 3820: -37,7 + 3821: -36,7 + 3822: -35,7 + 3823: -34,7 + 3948: -31,5 - node: cleanable: True color: '#EFB34199' id: WarnFullGreyscale decals: - 3896: -43,4 + 3778: -43,4 - node: color: '#F98AFFCC' id: WarnFullGreyscale decals: - 1192: -64,-37 - 1252: -90,-38 - 1575: -14,-54 - 1576: -17,-52 - 1612: -21,-64 - 1613: -20,-64 - 1614: -19,-64 - 1615: -19,-63 - 1616: -20,-63 - 1617: -21,-63 - 4164: -27,-43 - 4165: -27,-42 - 4166: -22,-42 - 4167: -22,-41 - 4168: -19,-44 - 4169: -19,-45 - 4170: -22,-46 - 4171: -22,-47 - 4173: -19,-41 - 4174: -19,-42 - 4175: -13,-45 - 4176: -12,-47 - 4177: -11,-47 - 4191: -19,-67 - 4192: -20,-67 - 4193: -21,-67 - 4203: -12,-60 - 4204: -8,-66 - 4205: -9,-66 - 4206: -10,-66 - 4207: -12,-69 - 4208: -14,-69 - 4209: -16,-69 + 1159: -64,-37 + 1219: -90,-38 + 1539: -14,-54 + 1540: -17,-52 + 1576: -21,-64 + 1577: -20,-64 + 1578: -19,-64 + 1579: -19,-63 + 1580: -20,-63 + 1581: -21,-63 + 4037: -27,-43 + 4038: -27,-42 + 4039: -22,-42 + 4040: -22,-41 + 4041: -19,-44 + 4042: -19,-45 + 4043: -22,-46 + 4044: -22,-47 + 4046: -19,-41 + 4047: -19,-42 + 4048: -13,-45 + 4049: -12,-47 + 4050: -11,-47 + 4064: -19,-67 + 4065: -20,-67 + 4066: -21,-67 + 4076: -12,-60 + 4077: -8,-66 + 4078: -9,-66 + 4079: -10,-66 + 4080: -12,-69 + 4081: -14,-69 + 4082: -16,-69 - node: color: '#FA750096' id: WarnFullGreyscale decals: - 4085: -36,-4 - 4086: -36,-5 - 4087: -36,-6 - 4088: -35,-8 - 4089: -33,-4 - 4090: -32,-7 + 3966: -36,-4 + 3967: -36,-5 + 3968: -36,-6 + 3969: -35,-8 + 3970: -33,-4 + 3971: -32,-7 - node: color: '#FA750099' id: WarnFullGreyscale decals: - 4097: -36,-8 + 3977: -36,-8 - node: color: '#FF9821CC' id: WarnFullGreyscale decals: - 1208: -64,-32 - 1240: -93,-32 + 1175: -64,-32 + 1207: -93,-32 - node: color: '#334E6DCC' id: WarnLineGreyscaleE decals: - 160: -24,14 - 288: -24,15 - 752: -76,-2 - 1205: -63,-33 - 1247: -91,-33 - 1272: -90,-36 - 1315: -87,-33 - 1316: -87,-37 - 1653: -10,4 - 5006: -30,14 - 5070: -15,11 - - node: - color: '#3EB38896' - id: WarnLineGreyscaleE - decals: - 4426: -46,21 + 129: -24,14 + 257: -24,15 + 721: -76,-2 + 1172: -63,-33 + 1214: -91,-33 + 1239: -90,-36 + 1282: -87,-33 + 1283: -87,-37 + 1616: -10,4 + 4809: -30,14 + 4873: -15,11 - node: color: '#52B4E9CC' id: WarnLineGreyscaleE decals: - 1197: -63,-37 - 1250: -91,-32 - 3724: -32,-20 - 4172: -33,-17 + 1164: -63,-37 + 1217: -91,-32 + 3611: -32,-20 + 4045: -33,-17 - node: color: '#9FED58CC' id: WarnLineGreyscaleE decals: - 218: -24,-6 - 219: -24,-5 - 220: -24,-4 - 221: -23,-10 - 222: -23,-15 - 640: -52,-21 - 641: -52,-25 - 642: -52,-31 - 1190: -63,-38 - 1256: -91,-37 + 187: -24,-6 + 188: -24,-5 + 189: -24,-4 + 190: -23,-10 + 191: -23,-15 + 609: -52,-21 + 610: -52,-25 + 611: -52,-31 + 1157: -63,-38 + 1223: -91,-37 - node: color: '#B3B3B3CC' id: WarnLineGreyscaleE decals: - 159: -24,12 - 422: 22,13 - 423: 22,6 - 424: 35,4 - 425: 35,5 - 426: 35,13 - 427: 35,14 - 453: -23,-24 - 454: -23,-25 - 1083: -7,-24 - 1084: -7,-25 - 1135: -15,-21 - 1136: -15,-28 - 1137: -21,-25 - 1138: -21,-24 - 3318: -3,-17 - 3319: -3,-16 - 3320: -3,-15 - 3321: -3,-14 - 3322: -3,-13 - 3323: -3,-12 - 3324: -3,-9 + 128: -24,12 + 391: 22,13 + 392: 22,6 + 393: 35,4 + 394: 35,5 + 395: 35,13 + 396: 35,14 + 422: -23,-24 + 423: -23,-25 + 1050: -7,-24 + 1051: -7,-25 + 1102: -15,-21 + 1103: -15,-28 + 1104: -21,-25 + 1105: -21,-24 + 3280: -3,-17 + 3281: -3,-16 + 3282: -3,-15 + 3283: -3,-14 + 3284: -3,-13 + 3285: -3,-12 + 3286: -3,-9 - node: color: '#BC863FCC' id: WarnLineGreyscaleE decals: - 691: -3,-35 - 1212: -63,-32 - 1508: 0,-31 - 1509: 0,-30 - 1510: 0,-27 - 1511: 0,-26 - 1519: 10,-28 - 1520: 10,-26 + 660: -3,-35 + 1179: -63,-32 + 1472: 0,-31 + 1473: 0,-30 + 1474: 0,-27 + 1475: 0,-26 + 1483: 10,-28 + 1484: 10,-26 - node: color: '#DE3A3ACC' id: WarnLineGreyscaleE decals: - 112: 1,2 - 823: 6,17 - 1473: 5,10 - 4919: 3,18 + 81: 1,2 + 790: 6,17 + 1437: 5,10 + 4722: 3,18 + 5294: 1,8 + 5314: 1,14 + - node: + color: '#EFB34196' + id: WarnLineGreyscaleE + decals: + 4970: -71,36 + 4998: -71,25 + 5015: -64,25 + 5051: -46,21 - node: color: '#EFB34199' id: WarnLineGreyscaleE decals: - 3974: -39,9 - 3978: -42,3 - 3987: -27,10 - 3988: -34,9 + 3856: -39,9 + 3860: -42,3 + 3869: -27,10 + 3870: -34,9 - node: color: '#F98AFFCC' id: WarnLineGreyscaleE decals: - 1253: -91,-38 - 1552: -11,-46 - 1559: -17,-42 - 1564: -24,-43 - 1606: -11,-60 - 1607: -11,-61 - 1608: -11,-63 - 1609: -11,-64 - 1611: -19,-65 - 4181: -19,-46 - 4956: -11,-72 - 4957: -11,-71 - 4960: -15,-72 - 4961: -15,-71 - 4964: -15,-64 - 4965: -15,-65 - 4966: -15,-66 + 1220: -91,-38 + 1516: -11,-46 + 1523: -17,-42 + 1528: -24,-43 + 1570: -11,-60 + 1571: -11,-61 + 1572: -11,-63 + 1573: -11,-64 + 1575: -19,-65 + 4054: -19,-46 + 4759: -11,-72 + 4760: -11,-71 + 4763: -15,-72 + 4764: -15,-71 + 4767: -15,-64 + 4768: -15,-65 + 4769: -15,-66 - node: - color: '#FA750096' + color: '#FA7500CC' id: WarnLineGreyscaleE decals: - 4113: -31,-5 + 4931: -31,-5 - node: color: '#334E6DCC' id: WarnLineGreyscaleN decals: - 107: -10,0 - 108: -14,0 - 776: -76,3 - 1621: -15,15 - 1622: -13,15 - 1654: -11,5 - 5053: -11,12 - 5054: -10,12 - - node: - color: '#3EB38896' - id: WarnLineGreyscaleN - decals: - 3993: -41,18 - 4424: -51,22 - 4425: -49,22 + 76: -10,0 + 77: -14,0 + 745: -76,3 + 1584: -15,15 + 1585: -13,15 + 1617: -11,5 + 4856: -11,12 + 4857: -10,12 - node: color: '#52B4E9CC' id: WarnLineGreyscaleN decals: - 1412: -31,-9 - 1413: -28,-8 - 1420: -34,-14 - 1421: -35,-14 - 1422: -39,-14 - 1445: -39,-10 - 1446: -44,-10 - 1447: -48,-10 - 1465: -47,-14 - 3741: -43,-7 + 1376: -31,-9 + 1377: -28,-8 + 1384: -34,-14 + 1385: -35,-14 + 1386: -39,-14 + 1409: -39,-10 + 1410: -44,-10 + 1411: -48,-10 + 1429: -47,-14 + 3628: -43,-7 - node: color: '#9FED58CC' id: WarnLineGreyscaleN decals: - 225: -29,-34 - 4519: 14,-4 + 194: -29,-34 + 4346: 14,-4 - node: color: '#B3B3B3CC' id: WarnLineGreyscaleN decals: - 136: -7,0 - 137: -8,0 - 138: -18,0 - 139: -19,0 - 140: -20,0 - 141: -21,0 - 259: -6,0 - 260: -22,0 - 261: -16,0 - 314: 18,0 - 613: -34,-34 - 624: -43,-34 - 625: -59,-34 - 726: -68,0 - 727: -65,0 - 728: -66,0 - 750: -74,0 - 777: -74,3 - 778: -68,3 - 779: -66,3 - 1085: -8,-22 + 105: -7,0 + 106: -8,0 + 107: -18,0 + 108: -19,0 + 109: -20,0 + 110: -21,0 + 228: -6,0 + 229: -22,0 + 230: -16,0 + 283: 18,0 + 582: -34,-34 + 593: -43,-34 + 594: -59,-34 + 695: -68,0 + 696: -65,0 + 697: -66,0 + 719: -74,0 + 746: -74,3 + 747: -68,3 + 748: -66,3 + 1052: -8,-22 - node: color: '#BC863FCC' id: WarnLineGreyscaleN decals: - 1243: -92,-33 - 1515: 7,-25 - 1541: 8,-31 - 1542: 9,-31 - 4816: 4,-30 - 4999: -5,-38 + 1210: -92,-33 + 1479: 7,-25 + 1505: 8,-31 + 1506: 9,-31 + 4638: 4,-30 + 4802: -5,-38 - node: color: '#DE3A3ACC' id: WarnLineGreyscaleN decals: - 1018: 0,-4 - 3690: 5,23 - 3691: 6,23 - 4893: -58,-38 + 985: 0,-4 + 3582: 5,23 + 3583: 6,23 + 4714: -58,-38 + 5188: 2,30 + 5189: 9,30 + 5190: 6,30 + - node: + color: '#EFB34196' + id: WarnLineGreyscaleN + decals: + 4964: -73,30 + 4999: -73,26 + 5046: -51,22 + 5047: -49,22 + 5049: -41,18 - node: color: '#EFB34199' id: WarnLineGreyscaleN decals: - 3949: -54,0 - 3971: -43,0 - 3975: -41,10 - 3983: -46,9 - 3985: -41,15 - 3990: -36,10 - 4054: -39,5 + 3831: -54,0 + 3853: -43,0 + 3857: -41,10 + 3865: -46,9 + 3867: -41,15 + 3872: -36,10 + 3935: -39,5 - node: color: '#F98AFFCC' id: WarnLineGreyscaleN decals: - 1549: -21,-41 - 1551: -14,-45 - 1565: -25,-42 - 1566: -26,-42 - 1571: -15,-49 - 1572: -16,-49 - 1587: -15,-60 - 1588: -16,-60 - 1589: -16,-63 - 1605: -8,-70 - 4971: -13,-67 - 4972: -14,-67 + 1513: -21,-41 + 1515: -14,-45 + 1529: -25,-42 + 1530: -26,-42 + 1535: -15,-49 + 1536: -16,-49 + 1551: -15,-60 + 1552: -16,-60 + 1553: -16,-63 + 1569: -8,-70 + 4774: -13,-67 + 4775: -14,-67 - node: color: '#FF9821CC' id: WarnLineGreyscaleN decals: - 1241: -93,-33 + 1208: -93,-33 - node: color: '#334E6DCC' id: WarnLineGreyscaleS decals: - 932: -56,-2 - 1619: -10,14 - 1620: -11,14 - 1623: -15,17 - 1624: -13,17 - 5057: -11,7 - - node: - color: '#3EB38896' - id: WarnLineGreyscaleS - decals: - 4405: -41,20 + 899: -56,-2 + 1582: -10,14 + 1583: -11,14 + 1586: -15,17 + 1587: -13,17 + 4860: -11,7 - node: color: '#52B4E9CC' id: WarnLineGreyscaleS decals: - 170: -28,-6 - 1423: -39,-17 - 1442: -43,-12 - 1443: -39,-12 - 1444: -47,-12 - 1452: -39,-8 - 4099: -43,-5 - 4110: -35,-12 - 4111: -34,-12 - 4292: -33,-23 - 4376: -48,-8 + 139: -28,-6 + 1387: -39,-17 + 1406: -43,-12 + 1407: -39,-12 + 1408: -47,-12 + 1416: -39,-8 + 3978: -43,-5 + 3989: -35,-12 + 3990: -34,-12 + 4165: -33,-23 + 4249: -48,-8 - node: color: '#639137CC' id: WarnLineGreyscaleS decals: - 1259: -93,-37 + 1226: -93,-37 - node: color: '#9FED58CC' id: WarnLineGreyscaleS decals: - 223: -44,-36 - 224: -42,-36 - 1183: 14,-2 - 1268: -90,-36 + 192: -44,-36 + 193: -42,-36 + 1150: 14,-2 + 1235: -90,-36 - node: color: '#B3B3B3CC' id: WarnLineGreyscaleS decals: - 601: -15,-36 - 602: -13,-36 - 603: -12,-36 - 604: -11,-36 - 605: -10,-36 - 606: -9,-36 - 635: -50,-36 - 729: -63,-2 - 730: -60,-2 - 740: -49,-2 - 741: -47,-2 - 742: -46,-2 - 749: -74,-4 - 1088: -8,-27 + 570: -15,-36 + 571: -13,-36 + 572: -12,-36 + 573: -11,-36 + 574: -10,-36 + 575: -9,-36 + 604: -50,-36 + 698: -63,-2 + 699: -60,-2 + 709: -49,-2 + 710: -47,-2 + 711: -46,-2 + 718: -74,-4 + 1055: -8,-27 - node: color: '#BC863FCC' id: WarnLineGreyscaleS decals: - 689: -7,-36 - 690: -5,-36 - 1513: 4,-28 - 1514: 5,-28 - 1522: 8,-29 - 1523: 9,-29 - 1539: 8,-34 - 1540: 9,-34 + 658: -7,-36 + 659: -5,-36 + 1477: 4,-28 + 1478: 5,-28 + 1486: 8,-29 + 1487: 9,-29 + 1503: 8,-34 + 1504: 9,-34 - node: color: '#DE3A3ACC' id: WarnLineGreyscaleS decals: - 126: 0,-2 - 127: 4,-2 - 128: 7,-2 - 946: -58,-36 - 1261: -92,-37 - 3664: 8,9 - 3692: 5,22 - 3693: 6,22 + 95: 0,-2 + 96: 4,-2 + 97: 7,-2 + 913: -58,-36 + 1228: -92,-37 + 3570: 8,9 + 3584: 5,22 + 3585: 6,22 + 5186: 6,29 + 5187: 5,29 + 5202: 6,32 + - node: + color: '#EFB34196' + id: WarnLineGreyscaleS + decals: + 4955: -69,29 + 4956: -77,29 + 5013: -73,28 + 5045: -57,20 + 5048: -41,20 - node: color: '#EFB34199' id: WarnLineGreyscaleS decals: - 3973: -47,6 - 3986: -41,12 - 3991: -46,11 - 3992: -41,17 - 4037: -36,12 - 4059: -37,3 - 4060: -38,3 + 3855: -47,6 + 3868: -41,12 + 3873: -46,11 + 3874: -41,17 + 3918: -36,12 + 3940: -37,3 + 3941: -38,3 - node: cleanable: True color: '#EFB34199' id: WarnLineGreyscaleS decals: - 3976: -43,2 + 3858: -43,2 - node: color: '#F98AFFCC' id: WarnLineGreyscaleS decals: - 583: -27,-36 - 584: -26,-36 - 585: -21,-39 - 1553: -15,-47 - 1554: -16,-47 - 1569: -16,-50 - 1570: -15,-50 - 1585: -16,-61 - 1586: -15,-61 - 4952: -9,-68 + 552: -27,-36 + 553: -26,-36 + 554: -21,-39 + 1517: -15,-47 + 1518: -16,-47 + 1533: -16,-50 + 1534: -15,-50 + 1549: -16,-61 + 1550: -15,-61 + 4755: -9,-68 - node: - color: '#FA750096' + color: '#FA7500CC' id: WarnLineGreyscaleS decals: - 4114: -33,-7 + 4930: -33,-7 - node: color: '#334E6DCC' id: WarnLineGreyscaleW decals: - 99: -4,14 - 251: -4,15 - 743: -74,-2 - 1071: -60,-34 - 1072: -60,-36 - 1273: -91,-35 - 1296: -94,-35 - 1299: -88,-36 - 1300: -88,-34 - 1387: -25,14 - 5055: -13,8 - 5056: -13,11 - 5071: -8,4 - - node: - color: '#3EB38896' - id: WarnLineGreyscaleW - decals: - 4423: -44,21 + 68: -4,14 + 220: -4,15 + 712: -74,-2 + 1038: -60,-34 + 1039: -60,-36 + 1240: -91,-35 + 1263: -94,-35 + 1266: -88,-36 + 1267: -88,-34 + 1351: -25,14 + 4858: -13,8 + 4859: -13,11 + 4874: -8,4 - node: color: '#52B4E9CC' id: WarnLineGreyscaleW decals: - 509: -29,-5 + 478: -29,-5 - node: color: '#639137CC' id: WarnLineGreyscaleW decals: - 1187: -63,-38 + 1154: -63,-38 - node: color: '#9FED58CC' id: WarnLineGreyscaleW decals: - 430: 21,16 - 638: -53,-30 - 639: -53,-26 - 983: -53,-21 - 4518: 13,-6 + 399: 21,16 + 607: -53,-30 + 608: -53,-26 + 950: -53,-21 + 4345: 13,-6 - node: color: '#B3B3B3CC' id: WarnLineGreyscaleW decals: - 158: -25,7 - 280: -28,18 - 420: 34,6 - 421: 34,13 - 429: 20,19 - 451: -5,-24 - 452: -5,-25 - 501: -25,-25 - 990: -56,-21 - 1119: -13,-21 - 1120: -13,-28 - 1131: -21,-24 - 1132: -21,-25 - 1133: -19,-24 - 1134: -19,-25 - 3275: -5,-11 - 3276: -5,-10 - 3298: -4,-7 - 3299: -4,-6 - 3300: -4,-5 - 4476: -4,-4 - 4939: -1,-9 + 127: -25,7 + 249: -28,18 + 389: 34,6 + 390: 34,13 + 398: 20,19 + 420: -5,-24 + 421: -5,-25 + 470: -25,-25 + 957: -56,-21 + 1086: -13,-21 + 1087: -13,-28 + 1098: -21,-24 + 1099: -21,-25 + 1100: -19,-24 + 1101: -19,-25 + 3237: -5,-11 + 3238: -5,-10 + 3260: -4,-7 + 3261: -4,-6 + 3262: -4,-5 + 4305: -4,-4 + 4742: -1,-9 - node: color: '#BC863FCC' id: WarnLineGreyscaleW decals: - 1266: -91,-32 - 1512: 2,-31 - 1516: 2,-27 - 4995: -4,-44 - 4998: -7,-39 + 1233: -91,-32 + 1476: 2,-31 + 1480: 2,-27 + 4798: -4,-44 + 4801: -7,-39 - node: color: '#DE3A3ACC' id: WarnLineGreyscaleW decals: - 506: -25,-22 - 507: -25,-20 - 508: -25,-19 - 811: 5,18 - 821: 3,7 - 822: 2,13 - 1201: -63,-33 - 1262: -91,-38 - 1474: 7,10 - 3665: 2,11 - 3682: 8,17 - 4496: 5,4 + 475: -25,-22 + 476: -25,-20 + 477: -25,-19 + 780: 5,18 + 789: 3,7 + 1168: -63,-33 + 1229: -91,-38 + 1438: 7,10 + 3578: 8,17 + 4324: 5,4 + 5306: 3,14 + - node: + color: '#EFB34196' + id: WarnLineGreyscaleW + decals: + 4971: -75,36 + 5014: -69,25 + 5042: -62,25 + 5050: -44,21 - node: color: '#EFB34199' id: WarnLineGreyscaleW decals: - 3977: -44,3 - 3982: -48,8 - 3989: -37,9 - 4035: -25,10 - 4061: -32,5 + 3859: -44,3 + 3864: -48,8 + 3871: -37,9 + 3916: -25,10 + 3942: -32,5 - node: color: '#F98AFFCC' id: WarnLineGreyscaleW decals: - 1193: -63,-37 - 1547: -22,-44 - 1548: -22,-43 - 1550: -17,-46 - 1563: -27,-44 - 1610: -17,-65 - 4955: -9,-71 - 4958: -13,-72 - 4959: -13,-71 - 4967: -12,-64 - 4968: -12,-66 - 4969: -12,-63 - 4970: -12,-65 + 1160: -63,-37 + 1511: -22,-44 + 1512: -22,-43 + 1514: -17,-46 + 1527: -27,-44 + 1574: -17,-65 + 4758: -9,-71 + 4761: -13,-72 + 4762: -13,-71 + 4770: -12,-64 + 4771: -12,-66 + 4772: -12,-63 + 4773: -12,-65 - node: color: '#FF9821CC' id: WarnLineGreyscaleW decals: - 1209: -63,-32 + 1176: -63,-32 - node: color: '#FFFFFFFF' id: WarnLineS decals: - 876: -56,-4 - 877: -56,-5 - 878: -56,-6 - 879: -56,-7 + 843: -56,-4 + 844: -56,-5 + 845: -56,-6 + 846: -56,-7 - node: color: '#FFFFFFFF' id: WoodTrimThinBox decals: - 1082: 8,-10 + 1049: 8,-10 - node: color: '#FFFFFFFF' id: WoodTrimThinCornerNe decals: - 943: -46,-4 - 950: 8,-4 - 1053: -37,-45 - 1060: -36,-38 - 1079: -29,-28 - 3288: -12,-4 + 910: -46,-4 + 917: 8,-4 + 1020: -37,-45 + 1027: -36,-38 + 1046: -29,-28 + 3250: -12,-4 - node: color: '#FFFFFFFF' id: WoodTrimThinCornerNw decals: - 942: -49,-4 - 951: 3,-4 - 1050: -39,-45 - 1059: -39,-38 - 1080: -32,-28 - 2487: -54,-41 - 3287: -13,-4 + 909: -49,-4 + 918: 3,-4 + 1017: -39,-45 + 1026: -39,-38 + 1047: -32,-28 + 2449: -54,-41 + 3249: -13,-4 - node: color: '#FFFFFFFF' id: WoodTrimThinCornerSe decals: - 940: -46,-5 - 1051: -37,-47 - 1058: -36,-39 - 2488: -52,-43 - 3293: -12,-7 - 4738: -29,-30 + 907: -46,-5 + 1018: -37,-47 + 1025: -36,-39 + 2450: -52,-43 + 3255: -12,-7 + 4565: -29,-30 - node: color: '#FFFFFFFF' id: WoodTrimThinCornerSw decals: - 941: -49,-5 - 997: 3,-8 - 1052: -39,-47 - 1061: -39,-39 - 1081: -32,-30 - 2490: -54,-43 - 3294: -13,-7 + 908: -49,-5 + 964: 3,-8 + 1019: -39,-47 + 1028: -39,-39 + 1048: -32,-30 + 2452: -54,-43 + 3256: -13,-7 - node: color: '#FFFFFFFF' id: WoodTrimThinEndS decals: - 996: 4,-10 + 963: 4,-10 - node: color: '#FFFFFFFF' id: WoodTrimThinInnerNe decals: - 1007: 6,-7 + 974: 6,-7 - node: color: '#FFFFFFFF' id: WoodTrimThinInnerNw decals: - 1006: 5,-7 + 973: 5,-7 - node: color: '#FFFFFFFF' id: WoodTrimThinInnerSe decals: - 980: 6,-4 - 1001: 4,-8 + 947: 6,-4 + 968: 4,-8 - node: color: '#FFFFFFFF' id: WoodTrimThinInnerSw decals: - 981: 5,-4 - 999: 7,-8 - 1000: 4,-8 + 948: 5,-4 + 966: 7,-8 + 967: 4,-8 - node: color: '#FFFFFFFF' id: WoodTrimThinLineE decals: - 952: 8,-9 - 953: 8,-8 - 954: 8,-7 - 955: 8,-6 - 956: 8,-5 - 969: 4,-9 - 976: 6,-6 - 977: 6,-5 - 1055: -37,-46 - 1075: -29,-29 - 2489: -52,-42 - 3289: -12,-5 - 3290: -12,-6 + 919: 8,-9 + 920: 8,-8 + 921: 8,-7 + 922: 8,-6 + 923: 8,-5 + 936: 4,-9 + 943: 6,-6 + 944: 6,-5 + 1022: -37,-46 + 1042: -29,-29 + 2451: -52,-42 + 3251: -12,-5 + 3252: -12,-6 - node: color: '#FFFFFFFF' id: WoodTrimThinLineN decals: - 933: -46,-3 - 934: -47,-3 - 935: -48,-3 - 936: -49,-3 - 937: -49,-4 - 938: -48,-4 - 939: -47,-4 - 957: 7,-4 - 958: 6,-4 - 959: 5,-4 - 960: 4,-4 - 970: 3,-7 - 975: 8,-7 - 1004: 7,-7 - 1005: 4,-7 - 1056: -38,-45 - 1064: -38,-38 - 1065: -37,-38 - 1076: -31,-28 - 1078: -30,-28 + 900: -46,-3 + 901: -47,-3 + 902: -48,-3 + 903: -49,-3 + 904: -49,-4 + 905: -48,-4 + 906: -47,-4 + 924: 7,-4 + 925: 6,-4 + 926: 5,-4 + 927: 4,-4 + 937: 3,-7 + 942: 8,-7 + 971: 7,-7 + 972: 4,-7 + 1023: -38,-45 + 1031: -38,-38 + 1032: -37,-38 + 1043: -31,-28 + 1045: -30,-28 - node: color: '#FFFFFFFF' id: WoodTrimThinLineS decals: - 944: -47,-5 - 945: -48,-5 - 964: 5,-10 - 965: 7,-10 - 966: 6,-10 - 973: 4,-4 - 974: 3,-4 - 978: 7,-4 - 979: 8,-4 - 982: 4,-17 - 1002: 5,-8 - 1003: 6,-8 - 1057: -38,-47 - 1062: -38,-39 - 1063: -37,-39 - 1073: -31,-30 - 1074: -30,-30 + 911: -47,-5 + 912: -48,-5 + 931: 5,-10 + 932: 7,-10 + 933: 6,-10 + 940: 4,-4 + 941: 3,-4 + 945: 7,-4 + 946: 8,-4 + 949: 4,-17 + 969: 5,-8 + 970: 6,-8 + 1024: -38,-47 + 1029: -38,-39 + 1030: -37,-39 + 1040: -31,-30 + 1041: -30,-30 - node: color: '#FFFFFFFF' id: WoodTrimThinLineW decals: - 961: 3,-5 - 962: 3,-6 - 963: 3,-7 - 967: 7,-9 - 968: 7,-10 - 971: 5,-6 - 972: 5,-5 - 998: 4,-9 - 1054: -39,-46 - 1077: -32,-29 - 1651: -14,8 - 3291: -13,-5 - 3292: -13,-6 + 928: 3,-5 + 929: 3,-6 + 930: 3,-7 + 934: 7,-9 + 935: 7,-10 + 938: 5,-6 + 939: 5,-5 + 965: 4,-9 + 1021: -39,-46 + 1044: -32,-29 + 1614: -14,8 + 3253: -13,-5 + 3254: -13,-6 - node: angle: 1.5707963267948966 rad color: '#80808099' id: arrow decals: - 4394: -76,-6 + 4267: -76,-6 - node: zIndex: 10 color: '#B7818651' id: arrow decals: - 5104: -32.95286,17.61088 + 4907: -32.95286,17.61088 - node: cleanable: True color: '#48000063' id: biohazard decals: - 2937: -21.006418,-49.984905 + 2899: -21.006418,-49.984905 - node: cleanable: True color: '#AAB3B47C' id: body decals: - 2587: -50.965786,-44.850903 + 2549: -50.965786,-44.850903 - node: cleanable: True angle: 0.7853981633974483 rad color: '#AAB3B47C' id: body decals: - 2585: -55.01266,-42.100903 + 2547: -55.01266,-42.100903 - node: cleanable: True angle: 3.141592653589793 rad color: '#AAB3B47C' id: body decals: - 2586: -53.41891,-38.100903 + 2548: -53.41891,-38.100903 - node: cleanable: True angle: 0.17453292519943295 rad color: '#E4DCE0BF' id: body decals: - 2208: -55.350708,-8.884533 + 2170: -55.350708,-8.884533 - node: cleanable: True zIndex: 10 color: '#B7818651' id: bottle decals: - 5107: -15.202014,-6.9944453 + 4910: -15.202014,-6.9944453 - node: cleanable: True angle: -0.2617993877991494 rad color: '#E40000BF' id: bottle decals: - 2209: -49.672386,-9.452461 + 2171: -49.672386,-9.452461 - node: zIndex: 10 color: '#B7818651' id: carp decals: - 5095: 1.0282984,-38.051735 + 4898: 1.0282984,-38.051735 - node: zIndex: 10 color: '#B7818651' id: clown decals: - 5094: 0.012550831,-18.999561 + 4897: 0.012550831,-18.999561 - node: cleanable: True color: '#5600006B' id: cyka decals: - 2159: -75,-7 + 2121: -75,-7 - node: cleanable: True color: '#56000084' id: cyka decals: - 2160: -75,-7 + 2122: -75,-7 - node: cleanable: True color: '#690000C3' id: cyka decals: - 2788: -42,-49 + 2750: -42,-49 - node: zIndex: 10 color: '#B7818651' id: cyka decals: - 5103: -36.988064,-25.359404 + 4906: -36.988064,-25.359404 - node: cleanable: True angle: 0.2617993877991494 rad color: '#C1AAAC6D' id: disk decals: - 2333: -34.034637,-26.040276 + 2295: -34.034637,-26.040276 - node: cleanable: True color: '#630000B6' id: end decals: - 2393: -46,-25 + 2355: -46,-25 - node: zIndex: 10 color: '#B7818651' id: face decals: - 5093: 10.266987,-23.21018 + 4896: 10.266987,-23.21018 - node: cleanable: True angle: -0.2617993877991494 rad color: '#C1B3BDBF' id: face decals: - 2210: -51.984886,-4.9993362 + 2172: -51.984886,-4.9993362 - node: cleanable: True color: '#82757C63' id: firedanger decals: - 2801: -49,-48 + 2763: -49,-48 - node: color: '#6B0000C0' id: guy decals: - 3461: 12.990083,20.413334 + 3423: 12.990083,20.413334 - node: zIndex: 10 color: '#B7818651' id: guy decals: - 5092: 9.042798,-12.986315 + 4895: 9.042798,-12.986315 - node: cleanable: True angle: -0.17453292519943295 rad color: '#C1AAAC6D' id: peace decals: - 2337: -39,-21 + 2299: -39,-21 - node: cleanable: True color: '#C1B3BDBF' id: plus decals: - 2211: -46.21617,-17.882368 - 2212: -45.981796,-17.866743 - 2213: -45.794296,-17.835493 + 2173: -46.21617,-17.882368 + 2174: -45.981796,-17.866743 + 2175: -45.794296,-17.835493 - node: cleanable: True angle: 0.6981317007977318 rad color: '#C1AAAC6D' id: questionmark decals: - 2336: -29,-26 + 2298: -29,-26 - node: cleanable: True color: '#C1AAAC6D' id: radiation decals: - 2334: -46,-21 + 2296: -46,-21 - node: cleanable: True color: '#847F7CA0' id: shop decals: - 3093: 1,-36 - 3095: 1,-36 - 3096: 1,-36 + 3055: 1,-36 + 3057: 1,-36 + 3058: 1,-36 - node: angle: 1.5707963267948966 rad color: '#80808099' id: skull decals: - 4395: -75,-6 + 4268: -75,-6 - node: zIndex: 10 color: '#B7818651' id: skull decals: - 5105: -32.938114,16.991411 + 4908: -32.938114,16.991411 - node: zIndex: 10 color: '#B7BCB051' id: skull decals: - 5090: 14,14 + 4893: 14,14 - node: cleanable: True angle: -0.4886921905584123 rad color: '#B8B9B88A' id: skull decals: - 2014: -66,-7 + 1976: -66,-7 - node: cleanable: True color: '#C1AAAC6D' id: skull decals: - 2335: -39,-26 + 2297: -39,-26 - node: zIndex: 10 color: '#B7818651' id: snake decals: - 5091: 11,10 + 4894: 11,10 - node: cleanable: True color: '#484F45A1' id: space decals: - 2942: -14,-41 - 2943: -14,-41 - 2944: -14,-41 - 2945: -14,-41 + 2904: -14,-41 + 2905: -14,-41 + 2906: -14,-41 + 2907: -14,-41 - node: cleanable: True color: '#4E000063' id: splatter decals: - 2554: -55.465786,-42.632153 - 2555: -55.340786,-42.350903 - 2556: -55.41891,-41.850903 - 2557: -55.41891,-41.850903 - 2558: -55.41891,-41.897778 - 2559: -55.45016,-42.163403 - 2560: -55.38766,-42.257153 - 2561: -55.38766,-42.257153 - 2562: -55.653286,-42.132153 - 2563: -55.184536,-42.491528 - 2564: -53.85641,-37.694653 - 2565: -53.715786,-37.679028 - 2566: -53.66891,-37.710278 - 2567: -53.66891,-37.804028 - 2568: -53.79391,-37.929028 - 2569: -53.88766,-38.022778 - 2570: -53.60641,-38.210278 - 2571: -53.32516,-37.694653 - 2572: -53.29391,-37.647778 - 2573: -53.559536,-37.710278 - 2574: -53.434536,-37.741528 - 2575: -53.01266,-37.475903 - 2576: -51.153286,-45.350903 - 2577: -51.090786,-45.350903 - 2578: -50.872036,-45.210278 - 2579: -50.73141,-45.022778 - 2580: -50.622036,-44.725903 - 2581: -50.903286,-45.397778 - 2582: -50.840786,-45.413403 - 2583: -50.66891,-45.319653 - 2584: -50.465786,-45.163403 + 2516: -55.465786,-42.632153 + 2517: -55.340786,-42.350903 + 2518: -55.41891,-41.850903 + 2519: -55.41891,-41.850903 + 2520: -55.41891,-41.897778 + 2521: -55.45016,-42.163403 + 2522: -55.38766,-42.257153 + 2523: -55.38766,-42.257153 + 2524: -55.653286,-42.132153 + 2525: -55.184536,-42.491528 + 2526: -53.85641,-37.694653 + 2527: -53.715786,-37.679028 + 2528: -53.66891,-37.710278 + 2529: -53.66891,-37.804028 + 2530: -53.79391,-37.929028 + 2531: -53.88766,-38.022778 + 2532: -53.60641,-38.210278 + 2533: -53.32516,-37.694653 + 2534: -53.29391,-37.647778 + 2535: -53.559536,-37.710278 + 2536: -53.434536,-37.741528 + 2537: -53.01266,-37.475903 + 2538: -51.153286,-45.350903 + 2539: -51.090786,-45.350903 + 2540: -50.872036,-45.210278 + 2541: -50.73141,-45.022778 + 2542: -50.622036,-44.725903 + 2543: -50.903286,-45.397778 + 2544: -50.840786,-45.413403 + 2545: -50.66891,-45.319653 + 2546: -50.465786,-45.163403 - node: cleanable: True color: '#51000059' id: splatter decals: - 1988: -55.37182,-8.443881 - 1989: -55.17043,-8.478603 - 1990: -55.05932,-8.499436 - - node: - color: '#5B2E00DD' - id: splatter - decals: - 3669: 2,34 + 1950: -55.37182,-8.443881 + 1951: -55.17043,-8.478603 + 1952: -55.05932,-8.499436 - node: cleanable: True color: '#6300006D' id: splatter decals: - 2338: -40.830013,-25.449554 - 2339: -40.830013,-25.43393 - 2340: -40.830013,-25.355804 - 2341: -40.923763,-24.730804 - 2342: -41.09564,-24.668304 - 2343: -41.15814,-24.77768 - 2344: -41.15814,-25.043304 - 2345: -41.048763,-25.21518 - 2346: -41.78314,-25.27768 - 2347: -41.736263,-25.387054 - 2348: -41.173763,-25.480804 - 2349: -41.173763,-25.480804 - 2350: -41.236263,-25.324554 - 2351: -41.236263,-25.199554 - 2352: -40.84564,-25.12143 - 2353: -40.84564,-24.90268 - 2354: -40.81439,-24.90268 - 2355: -40.705013,-25.199554 - 2356: -40.62689,-25.34018 - 2357: -40.56439,-25.418304 - 2358: -40.580013,-24.96518 - 2359: -40.580013,-24.62143 - 2360: -40.580013,-24.52768 - 2361: -40.517513,-24.168304 - 2362: -40.56439,-25.355804 - 2363: -40.580013,-25.62143 - 2364: -40.611263,-25.730804 - 2365: -40.611263,-25.793304 - 2366: -40.62689,-25.80893 - 2367: -40.81439,-25.71518 - 2368: -40.81439,-25.71518 + 2300: -40.830013,-25.449554 + 2301: -40.830013,-25.43393 + 2302: -40.830013,-25.355804 + 2303: -40.923763,-24.730804 + 2304: -41.09564,-24.668304 + 2305: -41.15814,-24.77768 + 2306: -41.15814,-25.043304 + 2307: -41.048763,-25.21518 + 2308: -41.78314,-25.27768 + 2309: -41.736263,-25.387054 + 2310: -41.173763,-25.480804 + 2311: -41.173763,-25.480804 + 2312: -41.236263,-25.324554 + 2313: -41.236263,-25.199554 + 2314: -40.84564,-25.12143 + 2315: -40.84564,-24.90268 + 2316: -40.81439,-24.90268 + 2317: -40.705013,-25.199554 + 2318: -40.62689,-25.34018 + 2319: -40.56439,-25.418304 + 2320: -40.580013,-24.96518 + 2321: -40.580013,-24.62143 + 2322: -40.580013,-24.52768 + 2323: -40.517513,-24.168304 + 2324: -40.56439,-25.355804 + 2325: -40.580013,-25.62143 + 2326: -40.611263,-25.730804 + 2327: -40.611263,-25.793304 + 2328: -40.62689,-25.80893 + 2329: -40.81439,-25.71518 + 2330: -40.81439,-25.71518 - node: cleanable: True color: '#6F380070' id: splatter decals: - 4745: -46,-32 - 4746: -46,-32 - - node: - cleanable: True - zIndex: 1 - color: '#780000FF' - id: splatter - decals: - 1618: 7,34 + 4572: -46,-32 + 4573: -46,-32 - node: cleanable: True color: '#8C4F0070' id: splatter decals: - 4743: -46,-32 + 4570: -46,-32 - node: cleanable: True color: '#96380070' id: splatter decals: - 4744: -46,-32 + 4571: -46,-32 - node: cleanable: True color: '#A60D0059' id: splatter decals: - 1987: -55.40654,-8.423048 - - node: - color: '#B39687DD' - id: splatter - decals: - 3666: 2,29 - - node: - color: '#B3C787DD' - id: splatter - decals: - 3668: 2,29 + 1949: -55.40654,-8.423048 - node: cleanable: True zIndex: 10 color: '#B7818651' id: stickman decals: - 5106: -15.003123,3.0394628 + 4909: -15.003123,3.0394628 - type: RadiationGridResistance - type: GridAtmosphere version: 2 @@ -7577,11 +7844,11 @@ entities: -1,1: 0: 47935 0,2: - 0: 64984 + 0: 65528 -1,2: 0: 48051 0,3: - 0: 56828 + 0: 49080 -1,3: 0: 48051 1,0: @@ -7595,7 +7862,7 @@ entities: 1,-1: 0: 65439 1,4: - 0: 26598 + 0: 28654 2,0: 0: 30479 2,1: @@ -7603,23 +7870,23 @@ entities: 2,2: 0: 15133 2,3: - 0: 28683 + 0: 57355 2,-1: 0: 65477 2,4: - 0: 30583 + 0: 61182 3,0: 0: 61951 3,1: 0: 39864 3,2: 0: 12159 - 3,3: - 0: 26215 3,-1: 0: 65358 + 3,3: + 0: 17478 3,4: - 0: 10790 + 0: 17476 4,0: 0: 65103 4,2: @@ -7687,55 +7954,54 @@ entities: 2,-5: 0: 21845 3,-3: - 0: 4335 - 1: 16384 + 0: 20719 3,-2: 0: 61408 3,-4: 0: 57344 - 2: 8 + 1: 8 4,-4: - 2: 61183 + 1: 61183 4,-3: 0: 1 - 2: 1646 + 1: 1646 4,-2: 0: 37120 5,-4: - 2: 17663 + 1: 17663 0: 43520 5,-3: 0: 43690 - 2: 17476 + 1: 17476 5,-2: 0: 2730 - 2: 1092 + 1: 1092 5,-5: - 2: 20224 + 1: 20224 6,-4: - 2: 17663 + 1: 17663 0: 43520 6,-3: 0: 43690 - 2: 17476 + 1: 17476 6,-2: 0: 2730 - 2: 1092 + 1: 1092 6,-5: - 2: 20224 + 1: 20224 7,-4: - 2: 17663 + 1: 17663 0: 43520 7,-3: 0: 43690 - 2: 17476 + 1: 17476 7,-2: 0: 2730 - 2: 1092 + 1: 1092 7,-5: - 2: 20224 + 1: 20224 8,-4: - 2: 17663 + 1: 17663 0: 43520 8,-1: 0: 65280 @@ -7754,42 +8020,42 @@ entities: 9,-1: 0: 4096 9,0: - 2: 224 + 1: 224 0: 24576 9,2: - 2: 3630 + 1: 3630 8,-3: 0: 43690 - 2: 17476 + 1: 17476 8,-2: 0: 2730 - 2: 1092 + 1: 1092 8,-5: - 2: 20224 + 1: 20224 9,-4: - 2: 17509 + 1: 17509 0: 16 9,-5: - 2: 18176 + 1: 18176 9,-3: - 2: 17476 + 1: 17476 9,-2: - 2: 1092 + 1: 1092 4,5: 0: 1543 3,5: - 0: 30574 + 0: 30540 4,6: - 2: 2 + 1: 2 5,5: 0: 1799 - 2: 4096 + 1: 4096 8,5: 0: 1092 9,4: - 2: 5104 + 1: 5104 9,5: - 2: 1 + 1: 1 -4,0: 0: 45535 -4,-1: @@ -7801,10 +8067,9 @@ entities: -5,1: 0: 58895 -4,2: - 0: 64142 + 0: 64398 -5,2: - 0: 55768 - 1: 1024 + 0: 56792 -4,3: 0: 65291 -5,3: @@ -7829,6 +8094,8 @@ entities: 0: 65280 -2,-1: 0: 65295 + -2,2: + 1: 24582 -1,4: 0: 65523 -4,-4: @@ -7837,9 +8104,9 @@ entities: 0: 49151 -4,-3: 0: 43145 - 3: 816 + 2: 816 -5,-3: - 3: 2176 + 2: 2176 0: 13107 -4,-2: 0: 64435 @@ -7859,7 +8126,7 @@ entities: 0: 65523 -2,-5: 0: 34952 - 2: 816 + 1: 816 -1,-5: 0: 62335 -8,0: @@ -7934,7 +8201,7 @@ entities: 0: 65435 -6,-5: 0: 13107 - 2: 2184 + 1: 2184 -5,-2: 0: 30583 -12,0: @@ -8030,15 +8297,13 @@ entities: -14,2: 0: 52430 -14,3: - 0: 52460 - -14,4: - 0: 3140 + 0: 17644 -13,1: 0: 9830 -13,3: 0: 26214 -13,4: - 0: 57570 + 0: 57586 -16,-3: 0: 62203 -17,-3: @@ -8088,10 +8353,10 @@ entities: -17,1: 0: 5 -20,-4: - 2: 112 + 1: 112 0: 65408 -21,-4: - 2: 32913 + 1: 32913 0: 3842 -20,-3: 0: 767 @@ -8118,60 +8383,60 @@ entities: -17,-5: 0: 16383 -24,-4: - 2: 4113 + 1: 4113 0: 3850 -24,-5: - 2: 4369 + 1: 4369 0: 43690 -25,-4: 0: 3080 - 2: 21335 + 1: 21335 -24,-3: - 2: 4369 + 1: 4369 0: 43690 -25,-3: 0: 34952 - 2: 9767 + 1: 9767 -24,-2: - 2: 41233 + 1: 41233 0: 2730 -25,-2: 0: 2184 - 2: 42534 + 1: 42534 -24,-1: - 2: 15 + 1: 15 -25,-1: - 2: 14 + 1: 14 -23,-4: - 2: 4113 + 1: 4113 0: 3850 -23,-3: - 2: 4369 + 1: 4369 0: 43690 -23,-2: - 2: 41233 + 1: 41233 0: 2730 -23,-1: - 2: 15 + 1: 15 -23,-5: - 2: 4369 + 1: 4369 0: 43690 -22,-4: - 2: 4113 + 1: 4113 0: 3850 -22,-3: - 2: 4369 + 1: 4369 0: 8738 -22,-2: - 2: 8465 + 1: 8465 0: 546 -22,-1: - 2: 7 + 1: 7 -22,-5: - 2: 4369 + 1: 4369 0: 43690 -21,-5: - 2: 4369 + 1: 4369 0: 8738 -21,-1: 0: 17408 @@ -8189,10 +8454,10 @@ entities: 0: 127 -4,7: 0: 28784 - 2: 34688 + 1: 34688 -5,7: 0: 61680 - 2: 3840 + 1: 3840 -3,4: 0: 65520 -3,5: @@ -8200,9 +8465,9 @@ entities: -3,6: 0: 15 -3,7: - 2: 28945 + 1: 28945 -3,8: - 2: 4381 + 1: 4381 -2,4: 0: 56784 -2,5: @@ -8211,19 +8476,22 @@ entities: 0: 3 -1,5: 0: 35000 + -1,7: + 0: 16384 + 1: 8 + -1,8: + 0: 4 + 1: 48 0,5: 0: 32526 - -1,7: - 2: 8 - 0: 32768 -4,-8: 0: 45056 - 2: 102 + 1: 102 -4,-7: 0: 48063 -5,-8: 0: 57344 - 2: 48 + 1: 48 -5,-7: 0: 65262 -4,-6: @@ -8232,22 +8500,22 @@ entities: 0: 61167 -4,-5: 0: 11 - 2: 1536 + 1: 1536 -5,-5: 0: 14 - 2: 768 + 1: 768 -3,-8: 0: 28672 - 2: 196 + 1: 196 -3,-7: 0: 65527 -3,-6: 0: 32767 -3,-5: 0: 7 - 2: 3072 + 1: 3072 -2,-8: - 2: 787 + 1: 787 0: 34952 -2,-7: 0: 64443 @@ -8308,17 +8576,17 @@ entities: -1,-12: 0: 45311 -1,-11: - 0: 47931 + 0: 15291 -1,-10: 0: 2035 -1,-13: 0: 65535 0,-12: - 0: 32819 + 0: 35891 0,-11: - 0: 1 + 0: 49 0,-10: - 0: 65336 + 0: 65328 0,-9: 0: 53759 -8,-8: @@ -8345,7 +8613,7 @@ entities: 0: 36863 -6,-8: 0: 13107 - 2: 34952 + 1: 34952 -6,-7: 0: 62259 -6,-6: @@ -8404,18 +8672,18 @@ entities: 0: 64736 -7,6: 0: 32767 - 2: 32768 + 1: 32768 -6,5: 0: 13104 -6,6: 0: 8959 - 2: 23808 + 1: 23808 -6,7: 0: 41634 - 2: 19520 + 1: 19520 -6,8: 0: 41634 - 2: 19520 + 1: 19520 -12,-13: 0: 48903 -13,-12: @@ -8464,9 +8732,9 @@ entities: 0: 65421 -17,-12: 0: 128 - 2: 1792 + 1: 1792 -16,-11: - 0: 29772 + 0: 29788 -16,-10: 0: 30471 -17,-10: @@ -8476,7 +8744,7 @@ entities: -17,-9: 0: 56797 -16,-8: - 0: 30471 + 0: 13831 -16,-12: 0: 32770 -15,-12: @@ -8534,65 +8802,80 @@ entities: -12,-5: 0: 1997 0,4: - 1: 32 - 0: 61120 - 0,6: - 2: 55488 - 0,7: - 2: 30 0: 61152 + 0,6: + 1: 55488 + 0,7: + 1: 14 + 0: 20192 0,8: - 0: 3298 + 0: 26151 1,5: 0: 65382 1,7: - 0: 65526 + 0: 20470 1,6: 0: 26214 1,8: - 0: 2332 - 2: 128 + 0: 65535 2,5: 0: 61184 2,6: - 2: 45360 + 1: 45360 2,7: - 0: 30576 - 2: 34944 + 0: 10096 2,8: - 0: 3847 - 2: 48 + 0: 26190 3,6: - 2: 5088 + 1: 5088 3,7: - 2: 1 - 0: 4096 + 1: 1 0,9: - 0: 1 + 0: 65535 -1,9: - 0: 34816 + 0: 34952 0,10: - 0: 16 - -1,10: - 0: 8 - 1,9: + 0: 1906 + 0,11: 0: 2048 + 1,9: + 0: 65520 + 1,10: + 0: 4095 + 1,11: + 0: 128 + 1,12: + 0: 2116 2,9: - 0: 8208 + 0: 65535 2,10: - 0: 32832 + 0: 3812 + 3,9: + 0: 4369 + 3,11: + 0: 4136 + 3,10: + 0: 32768 -16,6: - 0: 68 - -16,7: - 0: 16384 + 0: 3581 + -17,6: + 0: 4095 -16,5: - 0: 8 - -15,4: - 0: 4096 + 0: 52428 + -15,5: + 0: 8191 -15,6: - 0: 3276 + 0: 3549 + -16,8: + 0: 3784 + -15,4: + 0: 34944 -15,7: 0: 34952 + -14,4: + 0: 4080 + -14,5: + 0: 4063 -14,6: 0: 53247 -14,7: @@ -8601,8 +8884,6 @@ entities: 0: 34952 -14,8: 0: 65535 - -14,5: - 0: 3276 -13,5: 0: 45055 -13,6: @@ -8624,27 +8905,27 @@ entities: -11,5: 0: 4095 -11,6: - 2: 4369 - 4: 12 - 5: 3072 + 1: 4369 + 3: 12 + 4: 3072 -11,7: - 2: 4369 + 1: 4369 0: 12 - 6: 3072 + 5: 3072 -11,8: - 2: 17 + 1: 17 0: 37132 -10,4: 0: 49648 -10,5: 0: 273 -10,6: - 4: 1 - 5: 256 - 0: 17612 + 3: 1 + 4: 256 + 0: 136 -10,7: - 0: 69 - 6: 256 + 0: 5 + 5: 256 -10,8: 0: 65281 -9,7: @@ -8652,25 +8933,25 @@ entities: -9,8: 0: 30583 -8,-16: - 2: 4369 + 1: 4369 -8,-17: - 2: 4369 + 1: 4369 -9,-16: - 2: 52431 + 1: 52431 0: 12336 -8,-15: - 2: 4369 + 1: 4369 -9,-15: - 2: 52431 + 1: 52431 0: 48 -8,-14: - 2: 3 + 1: 3 0: 4352 -9,-14: - 2: 14 + 1: 14 0: 56448 -7,-14: - 0: 48 + 0: 16432 -7,-16: 0: 128 -6,-16: @@ -8714,71 +8995,73 @@ entities: 0,-13: 0: 4369 -8,-20: - 2: 28672 + 1: 28672 -9,-20: - 2: 61440 + 1: 61440 -8,-19: - 2: 4380 + 1: 4380 -9,-19: 0: 14464 - 2: 50265 + 1: 50265 -8,-18: - 2: 4369 + 1: 4369 -9,-18: - 2: 52431 + 1: 52431 0: 12336 -9,-17: - 2: 52431 + 1: 52431 0: 12336 -7,-19: - 2: 34959 + 1: 34959 -7,-20: - 2: 32768 + 1: 32768 -6,-20: - 2: 63488 + 1: 63488 -7,-18: - 2: 2184 + 1: 2184 0: 32768 -6,-18: 0: 37632 -7,-17: 0: 8 -5,-20: - 2: 20224 + 1: 20224 -5,-18: 0: 45448 -5,-19: 0: 7872 - 2: 4 + 1: 4 -4,-20: - 2: 20224 + 1: 20224 -4,-19: 0: 8191 -4,-18: 0: 61695 -3,-20: - 2: 36608 + 1: 36608 -3,-19: 0: 8049 -3,-18: 0: 47359 -2,-20: - 2: 4096 + 1: 4096 -2,-19: 0: 256 - 2: 2207 + 1: 2207 -2,-18: 0: 4369 -2,-17: 0: 273 + 1,-12: + 0: 29440 1,-10: - 0: 65295 + 0: 65292 1,-9: 0: 47167 + 1,-11: + 0: 198 1,-8: 0: 46011 - 1,-11: - 0: 4 2,-11: 0: 304 2,-10: @@ -8806,16 +9089,16 @@ entities: 3,-5: 0: 277 -12,9: - 2: 4368 + 1: 4368 0: 61156 -13,9: - 2: 240 + 1: 240 0: 28672 -12,10: - 2: 273 + 1: 273 0: 2286 -13,10: - 2: 3840 + 1: 3840 0: 28727 -11,9: 0: 32763 @@ -8828,15 +9111,15 @@ entities: -9,10: 0: 40 -9,11: - 2: 50372 + 1: 50372 -9,12: - 2: 196 + 1: 196 -8,10: 0: 49345 - 2: 3072 + 1: 3072 -8,11: 0: 61680 - 2: 3840 + 1: 3840 -11,-7: 0: 64799 -11,-6: @@ -8846,15 +9129,15 @@ entities: -10,-6: 0: 26182 -20,-8: - 2: 4096 + 1: 4096 -20,-7: - 2: 35939 + 1: 35939 -21,-8: - 2: 35939 + 1: 35939 -19,-7: - 2: 4096 + 1: 4096 -19,-6: - 2: 1123 + 1: 1123 0: 34816 -18,-6: 0: 65535 @@ -8863,213 +9146,261 @@ entities: -18,-8: 0: 50240 -20,-10: - 2: 61440 + 1: 61440 -21,-10: - 2: 61440 + 1: 61440 -20,-9: 0: 240 - 2: 61954 + 1: 61954 -21,-9: 0: 240 - 2: 62468 + 1: 62468 -19,-10: - 2: 62060 + 1: 62060 -19,-9: 0: 240 - 2: 63753 + 1: 63753 -19,-11: - 2: 32768 + 1: 32768 -18,-11: - 2: 4406 + 1: 4406 -18,-10: - 2: 12291 + 1: 12291 0: 17484 -18,-9: 0: 48 - 2: 12288 + 1: 12288 -18,-12: - 2: 51200 + 1: 51200 -17,-11: 0: 576 -13,-14: 0: 3072 -12,-16: - 2: 34952 + 1: 34952 -12,-17: - 2: 34952 + 1: 34952 -11,-16: - 2: 4126 + 1: 4126 0: 57568 -12,-15: - 2: 34952 + 1: 34952 -11,-15: - 2: 30 + 1: 30 0: 224 -11,-14: 0: 61440 -11,-17: 0: 57568 - 2: 4126 + 1: 4126 -10,-16: - 2: 15 + 1: 15 0: 61680 -10,-15: - 2: 15 + 1: 15 0: 240 -10,-17: 0: 61680 - 2: 15 + 1: 15 -10,-14: 0: 32768 - -16,8: - 0: 32768 -16,9: - 0: 8 + 0: 35968 -15,9: - 0: 4352 + 0: 4096 -15,10: - 0: 17410 + 0: 17426 -14,9: 0: 37136 - 2: 8928 + 1: 8928 -14,10: 0: 9 - 2: 3618 + 1: 3618 -14,11: 0: 65 -8,12: - 2: 245 + 1: 245 -7,10: 0: 61680 - 2: 3840 + 1: 3840 -7,11: 0: 61680 - 2: 3840 + 1: 3840 -7,9: 0: 61680 - 2: 3840 + 1: 3840 -7,12: - 2: 2293 + 1: 2293 -6,9: - 2: 23888 + 1: 23888 0: 41634 -6,10: - 2: 23888 + 1: 23888 0: 41634 -6,11: - 2: 23888 + 1: 23888 0: 41634 -6,12: 0: 2 - 2: 4000 + 1: 4000 -5,8: 0: 61680 - 2: 3840 + 1: 3840 -5,9: 0: 61680 - 2: 3840 + 1: 3840 -5,10: 0: 61680 - 2: 3840 + 1: 3840 -5,11: 0: 61680 - 2: 3840 + 1: 3840 -5,12: - 2: 245 + 1: 245 -4,8: 0: 28784 - 2: 34688 + 1: 34688 -4,9: 0: 28784 - 2: 34688 + 1: 34688 -4,10: 0: 28784 - 2: 34688 + 1: 34688 -4,11: 0: 28784 - 2: 34688 + 1: 34688 -4,12: - 2: 245 + 1: 245 -3,9: - 2: 4369 + 1: 4369 -3,10: - 2: 4369 + 1: 4369 -3,11: - 2: 4369 + 1: 4369 -3,12: - 2: 17 + 1: 17 -2,8: - 2: 241 - -1,8: - 2: 48 - 0: 16388 + 1: 241 + -1,11: + 0: 32770 4,-5: - 2: 3072 + 1: 3072 -12,-19: - 2: 34944 + 1: 34944 -11,-19: - 2: 6896 + 1: 6896 0: 57344 -12,-18: - 2: 34952 + 1: 34952 -11,-18: - 2: 4126 + 1: 4126 0: 57568 -10,-19: - 2: 2800 + 1: 2800 0: 61440 -10,-18: - 2: 15 + 1: 15 0: 61680 -25,-5: - 2: 9766 + 1: 9766 0: 34952 -25,-8: - 2: 8 + 1: 8 -24,-8: - 2: 57600 + 1: 57600 0: 8 -24,-6: - 2: 4527 + 1: 4527 0: 43520 -25,-6: - 2: 9902 + 1: 9902 0: 34816 -24,-9: 0: 50790 -23,-8: 0: 7 -23,-6: - 2: 4527 + 1: 4527 0: 43520 -23,-9: 0: 32382 -22,-8: 0: 1 - 2: 768 + 1: 768 -22,-6: - 2: 4527 + 1: 4527 0: 43520 -22,-9: 0: 29619 - 2: 34824 + 1: 34824 -21,-6: - 2: 4399 + 1: 4399 0: 8704 -24,-10: - 2: 1 + 1: 1 0: 51232 -25,-10: - 2: 18432 + 1: 18432 -24,-11: - 2: 57344 + 1: 57344 -23,-10: 0: 30464 -22,-10: - 2: 32771 + 1: 32771 0: 28928 -25,-9: - 2: 17476 + 1: 17476 + -21,5: + 0: 1152 + -20,7: + 1: 4096 + 0: 52428 + -20,8: + 1: 4369 + 0: 52428 + -20,6: + 0: 52428 + -19,6: + 0: 40413 + -19,7: + 0: 36863 + -19,8: + 0: 35771 + -18,6: + 0: 3067 + -18,7: + 0: 36863 + -18,5: + 0: 96 + -18,8: + 0: 36590 + -17,7: + 0: 4369 + 1: 16384 + -17,8: + 0: 4369 + 1: 17476 + -20,9: + 0: 12 + 1: 32768 + -20,10: + 0: 8192 + -19,9: + 0: 1263 + 1: 61440 + -18,9: + 0: 319 + 1: 61440 + -17,9: + 0: 1 + -17,10: + 0: 2048 + -21,8: + 0: 256 + -21,6: + 0: 272 + 2,12: + 0: 256 uniqueMixes: - volume: 2500 temperature: 293.15 @@ -9094,29 +9425,6 @@ entities: - 0 - 0 - 0 - - volume: 2500 - temperature: 293.14975 - moles: - - 20.078888 - - 75.53487 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - volume: 2500 immutable: True moles: @@ -9478,13 +9786,78 @@ entities: - type: Transform pos: 8.408675,-17.149057 parent: 2 + - uid: 13040 + components: + - type: Transform + pos: 4.461673,40.753098 + parent: 2 - proto: AcousticGuitarInstrument entities: + - uid: 1013 + components: + - type: Transform + pos: 4.4559183,40.6258 + parent: 2 - uid: 5887 components: - type: Transform pos: 9.544364,12.137335 parent: 2 + - uid: 11906 + components: + - type: Transform + pos: -60.560284,33.67317 + parent: 2 +- proto: ActionToggleBlock + entities: + - uid: 557 + components: + - type: Transform + parent: 556 + - type: InstantAction + container: 556 + - uid: 993 + components: + - type: Transform + parent: 992 + - type: InstantAction + container: 992 + - uid: 15975 + components: + - type: Transform + parent: 15974 + - type: InstantAction + container: 15974 + - uid: 15977 + components: + - type: Transform + parent: 15976 + - type: InstantAction + container: 15976 + - uid: 15979 + components: + - type: Transform + parent: 15978 + - type: InstantAction + container: 15978 + - uid: 15981 + components: + - type: Transform + parent: 15980 + - type: InstantAction + container: 15980 + - uid: 15987 + components: + - type: Transform + parent: 15986 + - type: InstantAction + container: 15986 + - uid: 15991 + components: + - type: Transform + parent: 15990 + - type: InstantAction + container: 15990 - proto: ActionToggleInternals entities: - uid: 6971 @@ -9505,28 +9878,40 @@ entities: parent: 7127 - type: InstantAction container: 7127 - - uid: 13060 + - uid: 8732 components: - type: Transform - parent: 13056 + parent: 15204 - type: InstantAction - container: 13056 - - uid: 14826 + container: 15204 + - uid: 15983 components: - type: Transform - parent: 14824 + parent: 15209 - type: InstantAction - container: 14824 + container: 15209 - proto: ActionToggleJetpack entities: - - uid: 14825 + - uid: 8453 components: - type: Transform - parent: 14824 + parent: 15204 - type: InstantAction - container: 14824 + container: 15204 + - uid: 15982 + components: + - type: Transform + parent: 15209 + - type: InstantAction + container: 15209 - proto: ActionToggleLight entities: + - uid: 546 + components: + - type: Transform + parent: 541 + - type: InstantAction + container: 541 - uid: 5540 components: - type: Transform @@ -9575,6 +9960,12 @@ entities: parent: 14231 - type: InstantAction container: 14231 + - uid: 15966 + components: + - type: Transform + parent: 15965 + - type: InstantAction + container: 15965 - proto: ActionToggleMagboots entities: - uid: 6934 @@ -9595,14 +9986,6 @@ entities: parent: 8146 - type: InstantAction container: 8146 -- proto: ActionToggleMagbootsSyndie - entities: - - uid: 14827 - components: - - type: Transform - parent: 14824 - - type: InstantAction - container: 14824 - proto: ActionToggleSuitPiece entities: - uid: 5813 @@ -9755,6 +10138,21 @@ entities: - 6356 - 2656 - 3424 + - uid: 6331 + components: + - type: Transform + pos: 8.5,31.5 + parent: 2 + - type: DeviceList + devices: + - 15792 + - 15709 + - 15788 + - 15791 + - 15786 + - 15790 + - 15785 + - 15789 - uid: 6344 components: - type: Transform @@ -10245,6 +10643,14 @@ entities: - 14710 - 14712 - 14714 + - uid: 15025 + components: + - type: Transform + pos: -73.5,31.5 + parent: 2 + - type: DeviceList + devices: + - 14877 - proto: AirCanister entities: - uid: 1955 @@ -10268,13 +10674,6 @@ entities: parent: 2 - type: PolymorphableCanister currentPrototype: AirCanister - - uid: 9486 - components: - - type: Transform - pos: 14.5,12.5 - parent: 2 - - type: PolymorphableCanister - currentPrototype: AirCanister - uid: 9626 components: - type: Transform @@ -10369,11 +10768,6 @@ entities: parent: 2 - proto: AirlockAtmosphericsGlassLocked entities: - - uid: 14690 - components: - - type: Transform - pos: -44.5,21.5 - parent: 2 - uid: 14691 components: - type: Transform @@ -10384,13 +10778,6 @@ entities: - type: Transform pos: -50.5,23.5 parent: 2 -- proto: AirlockAtmosphericsLocked - entities: - - uid: 14689 - components: - - type: Transform - pos: -40.5,19.5 - parent: 2 - proto: AirlockBarLocked entities: - uid: 137 @@ -10698,6 +11085,18 @@ entities: rot: -1.5707963267948966 rad pos: -40.5,11.5 parent: 2 + - uid: 15045 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -54.5,20.5 + parent: 2 + - uid: 15237 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -54.5,22.5 + parent: 2 - proto: AirlockEngineeringLocked entities: - uid: 163 @@ -10705,6 +11104,18 @@ entities: - type: Transform pos: 0.5,-33.5 parent: 2 + - uid: 166 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -69.5,25.5 + parent: 2 + - uid: 239 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -62.5,25.5 + parent: 2 - uid: 440 components: - type: Transform @@ -10755,6 +11166,30 @@ entities: - type: Transform pos: -53.5,1.5 parent: 2 + - uid: 14822 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -44.5,21.5 + parent: 2 + - uid: 15220 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -72.5,27.5 + parent: 2 + - uid: 15221 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -72.5,31.5 + parent: 2 + - uid: 15256 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -40.5,19.5 + parent: 2 - proto: AirlockEVAGlassLocked entities: - uid: 194 @@ -10882,24 +11317,32 @@ entities: rot: 3.141592653589793 rad pos: 36.5,13.5 parent: 2 + missingComponents: + - AccessReader - uid: 7803 components: - type: Transform rot: 3.141592653589793 rad pos: 36.5,14.5 parent: 2 + missingComponents: + - AccessReader - uid: 7804 components: - type: Transform rot: 3.141592653589793 rad pos: 36.5,4.5 parent: 2 + missingComponents: + - AccessReader - uid: 7805 components: - type: Transform rot: 3.141592653589793 rad pos: 36.5,5.5 parent: 2 + missingComponents: + - AccessReader - uid: 11392 components: - type: Transform @@ -10996,7 +11439,7 @@ entities: parent: 2 - proto: AirlockExternalShuttleLocked entities: - - uid: 7801 + - uid: 15654 components: - type: Transform rot: 3.141592653589793 rad @@ -11099,12 +11542,6 @@ entities: rot: 3.141592653589793 rad pos: -52.5,0.5 parent: 2 - - uid: 885 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 1.5,32.5 - parent: 2 - uid: 943 components: - type: Transform @@ -11323,6 +11760,16 @@ entities: rot: -1.5707963267948966 rad pos: -21.5,-23.5 parent: 2 + - uid: 15665 + components: + - type: Transform + pos: 10.5,40.5 + parent: 2 + - uid: 15794 + components: + - type: Transform + pos: 1.5,40.5 + parent: 2 - proto: AirlockGlassShuttle entities: - uid: 547 @@ -11513,6 +11960,9 @@ entities: - type: Transform pos: -25.5,-24.5 parent: 2 + - type: Door + secondsUntilStateChange: -20304.72 + state: Opening - uid: 1802 components: - type: Transform @@ -11553,16 +12003,6 @@ entities: - type: Transform pos: -12.5,-48.5 parent: 2 - - uid: 2452 - components: - - type: Transform - pos: 3.5,22.5 - parent: 2 - - uid: 2496 - components: - - type: Transform - pos: 8.5,22.5 - parent: 2 - uid: 2527 components: - type: Transform @@ -11634,6 +12074,12 @@ entities: rot: -1.5707963267948966 rad pos: -48.5,8.5 parent: 2 + - uid: 14690 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -56.5,19.5 + parent: 2 - proto: AirlockMaintHOPLocked entities: - uid: 698 @@ -11749,6 +12195,16 @@ entities: parent: 2 - proto: AirlockMaintSecLocked entities: + - uid: 117 + components: + - type: Transform + pos: 3.5,22.5 + parent: 2 + - uid: 200 + components: + - type: Transform + pos: 8.5,22.5 + parent: 2 - uid: 413 components: - type: Transform @@ -12013,11 +12469,6 @@ entities: parent: 2 - proto: AirlockSecurityGlassLocked entities: - - uid: 414 - components: - - type: Transform - pos: 1.5,13.5 - parent: 2 - uid: 447 components: - type: Transform @@ -12040,11 +12491,6 @@ entities: rot: 3.141592653589793 rad pos: 6.5,24.5 parent: 2 - - uid: 546 - components: - - type: Transform - pos: 1.5,11.5 - parent: 2 - uid: 548 components: - type: Transform @@ -12060,6 +12506,28 @@ entities: - type: Transform pos: 5.5,28.5 parent: 2 + - uid: 5844 + components: + - type: Transform + pos: 10.5,33.5 + parent: 2 + - uid: 5845 + components: + - type: Transform + pos: 9.5,31.5 + parent: 2 + - uid: 15793 + components: + - type: Transform + pos: 6.5,31.5 + parent: 2 +- proto: AirlockSecurityLocked + entities: + - uid: 8736 + components: + - type: Transform + pos: 2.5,14.5 + parent: 2 - proto: AirlockServiceCaptainLocked entities: - uid: 300 @@ -12130,12 +12598,6 @@ entities: rot: 1.5707963267948966 rad pos: 3.5,10.5 parent: 2 - - uid: 6343 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 6.5,29.5 - parent: 2 - uid: 6356 components: - type: Transform @@ -12343,12 +12805,6 @@ entities: - type: Transform pos: -42.5,10.5 parent: 2 - - uid: 2626 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: -64.5,-3.5 - parent: 2 - uid: 2629 components: - type: Transform @@ -12598,6 +13054,11 @@ entities: - type: Transform pos: -30.5,8.5 parent: 2 + - uid: 15015 + components: + - type: Transform + pos: -72.5,38.5 + parent: 2 - proto: APCElectronics entities: - uid: 5636 @@ -12777,6 +13238,17 @@ entities: - type: Transform pos: 14.5,-27.5 parent: 2 + - uid: 14915 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -72.5,31.5 + parent: 2 + - uid: 15613 + components: + - type: Transform + pos: 34.5,22.5 + parent: 2 - proto: AtmosFixFreezerMarker entities: - uid: 6674 @@ -12918,6 +13390,13 @@ entities: - type: Transform pos: -36.5,5.5 parent: 2 +- proto: BackgammonBoard + entities: + - uid: 15657 + components: + - type: Transform + pos: 4.4931474,41.68589 + parent: 2 - proto: BalloonNT entities: - uid: 8454 @@ -13052,11 +13531,6 @@ entities: - type: Transform pos: -16.5,12.5 parent: 2 - - uid: 2071 - components: - - type: Transform - pos: -0.5,15.5 - parent: 2 - uid: 5025 components: - type: Transform @@ -13067,10 +13541,20 @@ entities: - type: Transform pos: -6.5,5.5 parent: 2 - - uid: 5705 + - uid: 5831 components: - type: Transform - pos: -0.5,9.5 + pos: 9.5,41.5 + parent: 2 + - uid: 5915 + components: + - type: Transform + pos: 2.5,42.5 + parent: 2 + - uid: 5929 + components: + - type: Transform + pos: 11.5,41.5 parent: 2 - uid: 6373 components: @@ -13127,6 +13611,16 @@ entities: - type: Transform pos: -33.5,-29.5 parent: 2 + - uid: 11606 + components: + - type: Transform + pos: 0.5,41.5 + parent: 2 + - uid: 11664 + components: + - type: Transform + pos: 9.5,42.5 + parent: 2 - uid: 12907 components: - type: Transform @@ -13137,6 +13631,11 @@ entities: - type: Transform pos: -41.5,-3.5 parent: 2 + - uid: 15310 + components: + - type: Transform + pos: 2.5,41.5 + parent: 2 - proto: BedsheetBlack entities: - uid: 8635 @@ -13228,15 +13727,41 @@ entities: parent: 2 - proto: BedsheetOrange entities: - - uid: 117 + - uid: 4447 components: - type: Transform - pos: -0.5,15.5 + rot: 1.5707963267948966 rad + pos: 2.5,41.5 parent: 2 - - uid: 12323 + - uid: 5930 components: - type: Transform - pos: -0.5,9.5 + rot: 1.5707963267948966 rad + pos: 9.5,42.5 + parent: 2 + - uid: 5933 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 9.5,41.5 + parent: 2 + - uid: 5937 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 0.5,41.5 + parent: 2 + - uid: 11585 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 11.5,41.5 + parent: 2 + - uid: 11607 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 2.5,42.5 parent: 2 - proto: BedsheetQM entities: @@ -13549,6 +14074,22 @@ entities: - type: DeviceLinkSink links: - 6066 + - uid: 5860 + components: + - type: Transform + pos: 2.5,31.5 + parent: 2 + - type: DeviceLinkSink + links: + - 5867 + - uid: 5866 + components: + - type: Transform + pos: 1.5,33.5 + parent: 2 + - type: DeviceLinkSink + links: + - 11641 - uid: 5967 components: - type: Transform @@ -13605,6 +14146,54 @@ entities: - type: DeviceLinkSink links: - 7189 + - uid: 11628 + components: + - type: Transform + pos: -72.5,35.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15623 + - uid: 11632 + components: + - type: Transform + pos: -71.5,38.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15623 + - uid: 11633 + components: + - type: Transform + pos: -73.5,38.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15623 + - uid: 15193 + components: + - type: Transform + pos: -75.5,27.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15197 + - uid: 15194 + components: + - type: Transform + pos: -77.5,27.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15197 + - uid: 15195 + components: + - type: Transform + pos: -76.5,27.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15197 - proto: BlastDoorOpen entities: - uid: 5523 @@ -13639,6 +14228,105 @@ entities: - type: DeviceLinkSink links: - 5524 + - uid: 15153 + components: + - type: Transform + pos: -66.5,26.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15152 + - 15618 + - uid: 15154 + components: + - type: Transform + pos: -66.5,25.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15152 + - 15618 + - uid: 15155 + components: + - type: Transform + pos: -66.5,24.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15152 + - 15618 + - uid: 15156 + components: + - type: Transform + pos: -71.5,27.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15136 + - uid: 15158 + components: + - type: Transform + pos: -69.5,32.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15136 + - uid: 15159 + components: + - type: Transform + pos: -69.5,33.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15136 + - uid: 15160 + components: + - type: Transform + pos: -69.5,34.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15136 + - uid: 15161 + components: + - type: Transform + pos: -75.5,34.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15136 + - uid: 15162 + components: + - type: Transform + pos: -75.5,33.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15136 + - uid: 15163 + components: + - type: Transform + pos: -75.5,32.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15136 + - uid: 15164 + components: + - type: Transform + pos: -72.5,31.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15136 + - uid: 15232 + components: + - type: Transform + pos: -73.5,27.5 + parent: 2 + - type: DeviceLinkSink + links: + - 15136 - proto: BlockGameArcade entities: - uid: 1317 @@ -13656,11 +14344,11 @@ entities: parent: 2 - type: SpamEmitSound enabled: False - - uid: 8732 + - uid: 15952 components: - type: Transform rot: 1.5707963267948966 rad - pos: -0.5,13.5 + pos: 9.5,34.5 parent: 2 - type: SpamEmitSound enabled: False @@ -13728,6 +14416,13 @@ entities: - type: Transform pos: -27.5,-31.5 parent: 2 +- proto: BookTruth + entities: + - uid: 15760 + components: + - type: Transform + pos: 2.6653397,41.390457 + parent: 2 - proto: BoozeDispenser entities: - uid: 6637 @@ -13768,6 +14463,16 @@ entities: parent: 2 - proto: BoxBeanbag entities: + - uid: 7 + components: + - type: Transform + pos: 7.59847,32.757217 + parent: 2 + - uid: 614 + components: + - type: Transform + pos: 7.5867753,32.566868 + parent: 2 - uid: 6646 components: - type: Transform @@ -13804,94 +14509,6 @@ entities: - type: Transform pos: -38.652706,-38.282543 parent: 2 -- proto: BoxCardboard - entities: - - uid: 596 - components: - - type: MetaData - name: Коробка с припасами - - type: Transform - pos: 0.6962608,15.657063 - parent: 2 - - type: Storage - storedItems: - 1114: - position: 0,0 - _rotation: South - 1115: - position: 1,0 - _rotation: South - 1116: - position: 0,1 - _rotation: South - 1117: - position: 1,1 - _rotation: South - 1118: - position: 2,0 - _rotation: South - 1119: - position: 0,2 - _rotation: East - 1120: - position: 2,2 - _rotation: South - - type: ContainerContainer - containers: - storagebase: !type:Container - showEnts: False - occludes: True - ents: - - 1114 - - 1116 - - 1115 - - 1117 - - 1118 - - 1119 - - 1120 - - uid: 12702 - components: - - type: MetaData - name: Коробка с припасами - - type: Transform - pos: 0.70703006,9.556635 - parent: 2 - - type: Storage - storedItems: - 12703: - position: 0,0 - _rotation: South - 12704: - position: 1,0 - _rotation: South - 12708: - position: 2,2 - _rotation: South - 12705: - position: 0,1 - _rotation: South - 12706: - position: 1,1 - _rotation: South - 12707: - position: 2,0 - _rotation: South - 12709: - position: 0,2 - _rotation: East - - type: ContainerContainer - containers: - storagebase: !type:Container - showEnts: False - occludes: True - ents: - - 12703 - - 12704 - - 12705 - - 12706 - - 12708 - - 12709 - - 12707 - proto: BoxDarts entities: - uid: 5472 @@ -13946,20 +14563,32 @@ entities: parent: 2 - proto: BoxLethalshot entities: - - uid: 3853 - components: - - type: Transform - parent: 6720 - - type: Physics - canCollide: False - - type: InsideEntityStorage - uid: 3883 components: - type: Transform - parent: 6720 - - type: Physics - canCollide: False - - type: InsideEntityStorage + pos: 11.559904,16.78747 + parent: 2 +- proto: BoxShellTranquilizer + entities: + - uid: 15988 + components: + - type: Transform + pos: 11.5686865,16.832954 + parent: 2 +- proto: BoxShotgunIncendiary + entities: + - uid: 15984 + components: + - type: Transform + pos: 11.543349,16.865673 + parent: 2 +- proto: BoxShotgunSlug + entities: + - uid: 15985 + components: + - type: Transform + pos: 11.541571,16.846703 + parent: 2 - proto: BrbSign entities: - uid: 6937 @@ -13969,25 +14598,50 @@ entities: parent: 2 - proto: BrigTimer entities: - - uid: 342 + - uid: 5917 components: - type: Transform - rot: -1.5707963267948966 rad - pos: 1.5,10.5 + rot: 3.141592653589793 rad + pos: 11.5,30.5 parent: 2 - - uid: 12690 + - type: DeviceLinkSource + linkedPorts: + 15936: + - Start: Off + - Timer: On + - uid: 5918 components: - type: Transform - rot: -1.5707963267948966 rad - pos: 1.5,14.5 + rot: 3.141592653589793 rad + pos: 11.5,29.5 parent: 2 -- proto: BrutepackAdvanced1 - entities: - - uid: 9496 + - type: DeviceLinkSource + linkedPorts: + 15933: + - Start: Off + - Timer: On + - uid: 11592 components: - type: Transform - pos: -27.725552,-16.267878 + rot: 3.141592653589793 rad + pos: 0.5,29.5 parent: 2 + - type: DeviceLinkSource + linkedPorts: + 15937: + - Start: Off + - Timer: On + - uid: 12239 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 0.5,30.5 + parent: 2 + - type: DeviceLinkSource + linkedPorts: + 15938: + - Start: Off + - Timer: On - proto: Bucket entities: - uid: 529 @@ -13995,16 +14649,28 @@ entities: - type: Transform pos: -57.80567,-14.32648 parent: 2 - - uid: 5929 + - uid: 997 components: - type: Transform - pos: 8.261547,29.540771 + pos: 12.277589,39.625134 parent: 2 + - uid: 8147 + components: + - type: Transform + parent: 8299 + - type: Physics + canCollide: False + - type: InsideEntityStorage - uid: 9608 components: - type: Transform pos: -40.294956,-52.461815 parent: 2 + - uid: 11557 + components: + - type: Transform + pos: 12.585637,39.800426 + parent: 2 - uid: 14235 components: - type: Transform @@ -14015,6 +14681,11 @@ entities: - type: Transform pos: -57.16814,-14.268267 parent: 2 + - uid: 14832 + components: + - type: Transform + pos: 16.280304,15.516066 + parent: 2 - proto: ButtonFrameCaution entities: - uid: 1983 @@ -14052,6 +14723,11 @@ entities: rot: 3.141592653589793 rad pos: -9.5,-68.5 parent: 2 + - uid: 8745 + components: + - type: Transform + pos: 1.5,16.5 + parent: 2 - uid: 12479 components: - type: Transform @@ -14062,12 +14738,6 @@ entities: - type: Transform pos: 0.5,8.5 parent: 2 - - uid: 12489 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 1.5,12.5 - parent: 2 - uid: 12490 components: - type: Transform @@ -14124,6 +14794,35 @@ entities: rot: 1.5707963267948966 rad pos: -13.5,9.5 parent: 2 + - uid: 15139 + components: + - type: Transform + pos: -64.5,27.5 + parent: 2 + - uid: 15148 + components: + - type: Transform + pos: -71.5,31.5 + parent: 2 + - uid: 15196 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -74.5,27.5 + parent: 2 + - uid: 15619 + components: + - type: Transform + pos: -67.5,27.5 + parent: 2 +- proto: ButtonFrameCautionSecurity + entities: + - uid: 15624 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -70.5,27.5 + parent: 2 - proto: ButtonFrameGrey entities: - uid: 12491 @@ -14199,6 +14898,26 @@ entities: - type: Transform pos: 28.5,1.5 parent: 2 + - uid: 208 + components: + - type: Transform + pos: 14.5,20.5 + parent: 2 + - uid: 210 + components: + - type: Transform + pos: 14.5,18.5 + parent: 2 + - uid: 213 + components: + - type: Transform + pos: 14.5,15.5 + parent: 2 + - uid: 215 + components: + - type: Transform + pos: 14.5,17.5 + parent: 2 - uid: 228 components: - type: Transform @@ -14209,6 +14928,21 @@ entities: - type: Transform pos: -73.5,2.5 parent: 2 + - uid: 232 + components: + - type: Transform + pos: 14.5,16.5 + parent: 2 + - uid: 234 + components: + - type: Transform + pos: 14.5,14.5 + parent: 2 + - uid: 242 + components: + - type: Transform + pos: 14.5,22.5 + parent: 2 - uid: 257 components: - type: Transform @@ -14224,6 +14958,11 @@ entities: - type: Transform pos: -34.5,-2.5 parent: 2 + - uid: 523 + components: + - type: Transform + pos: 14.5,19.5 + parent: 2 - uid: 542 components: - type: Transform @@ -14234,6 +14973,11 @@ entities: - type: Transform pos: 7.5,6.5 parent: 2 + - uid: 560 + components: + - type: Transform + pos: 1.5,32.5 + parent: 2 - uid: 595 components: - type: Transform @@ -14319,11 +15063,26 @@ entities: - type: Transform pos: -49.5,33.5 parent: 2 + - uid: 1884 + components: + - type: Transform + pos: -76.5,33.5 + parent: 2 - uid: 2203 components: - type: Transform pos: -52.5,-20.5 parent: 2 + - uid: 2223 + components: + - type: Transform + pos: -77.5,26.5 + parent: 2 + - uid: 2225 + components: + - type: Transform + pos: -77.5,28.5 + parent: 2 - uid: 2244 components: - type: Transform @@ -14334,11 +15093,36 @@ entities: - type: Transform pos: -44.5,-18.5 parent: 2 + - uid: 2252 + components: + - type: Transform + pos: -75.5,29.5 + parent: 2 + - uid: 2417 + components: + - type: Transform + pos: -69.5,29.5 + parent: 2 + - uid: 2418 + components: + - type: Transform + pos: -68.5,30.5 + parent: 2 + - uid: 2429 + components: + - type: Transform + pos: -73.5,29.5 + parent: 2 - uid: 2624 components: - type: Transform pos: -17.5,-9.5 parent: 2 + - uid: 2626 + components: + - type: Transform + pos: -68.5,29.5 + parent: 2 - uid: 2639 components: - type: Transform @@ -14414,71 +15198,6 @@ entities: - type: Transform pos: 4.5,28.5 parent: 2 - - uid: 4441 - components: - - type: Transform - pos: 4.5,29.5 - parent: 2 - - uid: 4442 - components: - - type: Transform - pos: 4.5,30.5 - parent: 2 - - uid: 4443 - components: - - type: Transform - pos: 5.5,30.5 - parent: 2 - - uid: 4444 - components: - - type: Transform - pos: 6.5,30.5 - parent: 2 - - uid: 4445 - components: - - type: Transform - pos: 7.5,30.5 - parent: 2 - - uid: 4446 - components: - - type: Transform - pos: 8.5,30.5 - parent: 2 - - uid: 4447 - components: - - type: Transform - pos: 9.5,30.5 - parent: 2 - - uid: 4448 - components: - - type: Transform - pos: 9.5,31.5 - parent: 2 - - uid: 4449 - components: - - type: Transform - pos: 3.5,30.5 - parent: 2 - - uid: 4450 - components: - - type: Transform - pos: 2.5,30.5 - parent: 2 - - uid: 4451 - components: - - type: Transform - pos: 3.5,31.5 - parent: 2 - - uid: 4452 - components: - - type: Transform - pos: 3.5,32.5 - parent: 2 - - uid: 4453 - components: - - type: Transform - pos: 3.5,33.5 - parent: 2 - uid: 4454 components: - type: Transform @@ -17004,21 +17723,86 @@ entities: - type: Transform pos: 3.5,10.5 parent: 2 + - uid: 5626 + components: + - type: Transform + pos: -74.5,29.5 + parent: 2 + - uid: 5629 + components: + - type: Transform + pos: -68.5,25.5 + parent: 2 + - uid: 5630 + components: + - type: Transform + pos: -72.5,25.5 + parent: 2 + - uid: 5638 + components: + - type: Transform + pos: -70.5,25.5 + parent: 2 + - uid: 5641 + components: + - type: Transform + pos: -75.5,36.5 + parent: 2 + - uid: 5643 + components: + - type: Transform + pos: -72.5,28.5 + parent: 2 - uid: 5668 components: - type: Transform pos: -26.5,10.5 parent: 2 + - uid: 5693 + components: + - type: Transform + pos: -73.5,36.5 + parent: 2 - uid: 5697 components: - type: Transform pos: -30.5,15.5 parent: 2 + - uid: 5713 + components: + - type: Transform + pos: -77.5,34.5 + parent: 2 + - uid: 5714 + components: + - type: Transform + pos: -77.5,36.5 + parent: 2 + - uid: 5726 + components: + - type: Transform + pos: -60.5,23.5 + parent: 2 + - uid: 5749 + components: + - type: Transform + pos: -59.5,21.5 + parent: 2 + - uid: 5762 + components: + - type: Transform + pos: -54.5,21.5 + parent: 2 - uid: 5942 components: - type: Transform pos: -46.5,25.5 parent: 2 + - uid: 5947 + components: + - type: Transform + pos: -58.5,21.5 + parent: 2 - uid: 5961 components: - type: Transform @@ -17204,6 +17988,11 @@ entities: - type: Transform pos: -48.5,33.5 parent: 2 + - uid: 6036 + components: + - type: Transform + pos: -51.5,17.5 + parent: 2 - uid: 6041 components: - type: Transform @@ -17324,16 +18113,6 @@ entities: - type: Transform pos: -32.5,20.5 parent: 2 - - uid: 6664 - components: - - type: Transform - pos: 1.5,29.5 - parent: 2 - - uid: 6665 - components: - - type: Transform - pos: 1.5,30.5 - parent: 2 - uid: 6683 components: - type: Transform @@ -19557,7 +20336,27 @@ entities: - uid: 7929 components: - type: Transform - pos: -13.5,-18.5 + pos: -36.5,-24.5 + parent: 2 + - uid: 8170 + components: + - type: Transform + pos: -57.5,21.5 + parent: 2 + - uid: 8171 + components: + - type: Transform + pos: -53.5,21.5 + parent: 2 + - uid: 8172 + components: + - type: Transform + pos: -56.5,21.5 + parent: 2 + - uid: 8176 + components: + - type: Transform + pos: -55.5,21.5 parent: 2 - uid: 8182 components: @@ -19644,6 +20443,11 @@ entities: - type: Transform pos: 0.5,-4.5 parent: 2 + - uid: 8361 + components: + - type: Transform + pos: -76.5,36.5 + parent: 2 - uid: 8387 components: - type: Transform @@ -19674,6 +20478,11 @@ entities: - type: Transform pos: -43.5,-30.5 parent: 2 + - uid: 8450 + components: + - type: Transform + pos: -77.5,35.5 + parent: 2 - uid: 8463 components: - type: Transform @@ -19979,6 +20788,11 @@ entities: - type: Transform pos: -36.5,-38.5 parent: 2 + - uid: 8734 + components: + - type: Transform + pos: -72.5,26.5 + parent: 2 - uid: 8766 components: - type: Transform @@ -20289,6 +21103,41 @@ entities: - type: Transform pos: -54.5,0.5 parent: 2 + - uid: 9328 + components: + - type: Transform + pos: -66.5,25.5 + parent: 2 + - uid: 9329 + components: + - type: Transform + pos: -65.5,25.5 + parent: 2 + - uid: 9330 + components: + - type: Transform + pos: -69.5,25.5 + parent: 2 + - uid: 9331 + components: + - type: Transform + pos: -71.5,25.5 + parent: 2 + - uid: 9332 + components: + - type: Transform + pos: -67.5,25.5 + parent: 2 + - uid: 9333 + components: + - type: Transform + pos: -71.5,29.5 + parent: 2 + - uid: 9339 + components: + - type: Transform + pos: -70.5,29.5 + parent: 2 - uid: 9344 components: - type: Transform @@ -20319,6 +21168,21 @@ entities: - type: Transform pos: -50.5,29.5 parent: 2 + - uid: 9481 + components: + - type: Transform + pos: -72.5,29.5 + parent: 2 + - uid: 9486 + components: + - type: Transform + pos: -68.5,31.5 + parent: 2 + - uid: 9522 + components: + - type: Transform + pos: -68.5,32.5 + parent: 2 - uid: 9546 components: - type: Transform @@ -20329,6 +21193,11 @@ entities: - type: Transform pos: -52.5,29.5 parent: 2 + - uid: 9583 + components: + - type: Transform + pos: -77.5,29.5 + parent: 2 - uid: 9888 components: - type: Transform @@ -21584,6 +22453,11 @@ entities: - type: Transform pos: -28.5,14.5 parent: 2 + - uid: 11454 + components: + - type: Transform + pos: -77.5,27.5 + parent: 2 - uid: 11471 components: - type: Transform @@ -21714,6 +22588,11 @@ entities: - type: Transform pos: -54.5,29.5 parent: 2 + - uid: 11890 + components: + - type: Transform + pos: -77.5,25.5 + parent: 2 - uid: 12215 components: - type: Transform @@ -21744,6 +22623,11 @@ entities: - type: Transform pos: -57.5,-13.5 parent: 2 + - uid: 12248 + components: + - type: Transform + pos: -77.5,33.5 + parent: 2 - uid: 12386 components: - type: Transform @@ -22099,46 +22983,6 @@ entities: - type: Transform pos: 12.5,22.5 parent: 2 - - uid: 13259 - components: - - type: Transform - pos: 13.5,21.5 - parent: 2 - - uid: 13260 - components: - - type: Transform - pos: 13.5,20.5 - parent: 2 - - uid: 13261 - components: - - type: Transform - pos: 13.5,18.5 - parent: 2 - - uid: 13262 - components: - - type: Transform - pos: 13.5,17.5 - parent: 2 - - uid: 13263 - components: - - type: Transform - pos: 13.5,19.5 - parent: 2 - - uid: 13264 - components: - - type: Transform - pos: 13.5,16.5 - parent: 2 - - uid: 13265 - components: - - type: Transform - pos: 13.5,15.5 - parent: 2 - - uid: 13266 - components: - - type: Transform - pos: 13.5,14.5 - parent: 2 - uid: 13267 components: - type: Transform @@ -22149,11 +22993,6 @@ entities: - type: Transform pos: 13.5,11.5 parent: 2 - - uid: 13269 - components: - - type: Transform - pos: 13.5,13.5 - parent: 2 - uid: 13270 components: - type: Transform @@ -22704,11 +23543,6 @@ entities: - type: Transform pos: 1.5,28.5 parent: 2 - - uid: 14419 - components: - - type: Transform - pos: 8.5,29.5 - parent: 2 - uid: 14420 components: - type: Transform @@ -22784,6 +23618,471 @@ entities: - type: Transform pos: -15.5,-5.5 parent: 2 + - uid: 14960 + components: + - type: Transform + pos: -68.5,34.5 + parent: 2 + - uid: 14976 + components: + - type: Transform + pos: -77.5,31.5 + parent: 2 + - uid: 14981 + components: + - type: Transform + pos: -60.5,24.5 + parent: 2 + - uid: 14983 + components: + - type: Transform + pos: -60.5,22.5 + parent: 2 + - uid: 14984 + components: + - type: Transform + pos: -70.5,36.5 + parent: 2 + - uid: 14985 + components: + - type: Transform + pos: -71.5,36.5 + parent: 2 + - uid: 14986 + components: + - type: Transform + pos: -74.5,36.5 + parent: 2 + - uid: 14987 + components: + - type: Transform + pos: -64.5,25.5 + parent: 2 + - uid: 14988 + components: + - type: Transform + pos: -62.5,25.5 + parent: 2 + - uid: 14989 + components: + - type: Transform + pos: -63.5,25.5 + parent: 2 + - uid: 14990 + components: + - type: Transform + pos: -60.5,25.5 + parent: 2 + - uid: 14991 + components: + - type: Transform + pos: -61.5,25.5 + parent: 2 + - uid: 14992 + components: + - type: Transform + pos: -68.5,36.5 + parent: 2 + - uid: 14993 + components: + - type: Transform + pos: -68.5,35.5 + parent: 2 + - uid: 14994 + components: + - type: Transform + pos: -69.5,36.5 + parent: 2 + - uid: 14995 + components: + - type: Transform + pos: -76.5,25.5 + parent: 2 + - uid: 14996 + components: + - type: Transform + pos: -76.5,29.5 + parent: 2 + - uid: 14997 + components: + - type: Transform + pos: -77.5,30.5 + parent: 2 + - uid: 15013 + components: + - type: Transform + pos: -77.5,32.5 + parent: 2 + - uid: 15014 + components: + - type: Transform + pos: -60.5,21.5 + parent: 2 + - uid: 15024 + components: + - type: Transform + pos: 14.5,21.5 + parent: 2 + - uid: 15034 + components: + - type: Transform + pos: 14.5,13.5 + parent: 2 + - uid: 15110 + components: + - type: Transform + pos: -72.5,38.5 + parent: 2 + - uid: 15111 + components: + - type: Transform + pos: -72.5,37.5 + parent: 2 + - uid: 15112 + components: + - type: Transform + pos: -72.5,36.5 + parent: 2 + - uid: 15113 + components: + - type: Transform + pos: -72.5,35.5 + parent: 2 + - uid: 15114 + components: + - type: Transform + pos: -72.5,34.5 + parent: 2 + - uid: 15115 + components: + - type: Transform + pos: -72.5,33.5 + parent: 2 + - uid: 15116 + components: + - type: Transform + pos: -72.5,32.5 + parent: 2 + - uid: 15117 + components: + - type: Transform + pos: -72.5,31.5 + parent: 2 + - uid: 15118 + components: + - type: Transform + pos: -72.5,30.5 + parent: 2 + - uid: 15119 + components: + - type: Transform + pos: -73.5,33.5 + parent: 2 + - uid: 15120 + components: + - type: Transform + pos: -74.5,33.5 + parent: 2 + - uid: 15121 + components: + - type: Transform + pos: -75.5,33.5 + parent: 2 + - uid: 15122 + components: + - type: Transform + pos: -71.5,33.5 + parent: 2 + - uid: 15123 + components: + - type: Transform + pos: -70.5,33.5 + parent: 2 + - uid: 15124 + components: + - type: Transform + pos: -69.5,33.5 + parent: 2 + - uid: 15125 + components: + - type: Transform + pos: -68.5,33.5 + parent: 2 + - uid: 15219 + components: + - type: Transform + pos: 14.5,12.5 + parent: 2 + - uid: 15260 + components: + - type: Transform + pos: -55.5,17.5 + parent: 2 + - uid: 15291 + components: + - type: Transform + pos: -54.5,17.5 + parent: 2 + - uid: 15330 + components: + - type: Transform + pos: -52.5,17.5 + parent: 2 + - uid: 15333 + components: + - type: Transform + pos: -53.5,17.5 + parent: 2 + - uid: 15664 + components: + - type: Transform + pos: 2.5,31.5 + parent: 2 + - uid: 15666 + components: + - type: Transform + pos: 4.5,30.5 + parent: 2 + - uid: 15667 + components: + - type: Transform + pos: 4.5,29.5 + parent: 2 + - uid: 15668 + components: + - type: Transform + pos: 2.5,30.5 + parent: 2 + - uid: 15669 + components: + - type: Transform + pos: 3.5,30.5 + parent: 2 + - uid: 15670 + components: + - type: Transform + pos: 2.5,32.5 + parent: 2 + - uid: 15672 + components: + - type: Transform + pos: 1.5,33.5 + parent: 2 + - uid: 15673 + components: + - type: Transform + pos: 1.5,34.5 + parent: 2 + - uid: 15674 + components: + - type: Transform + pos: 1.5,35.5 + parent: 2 + - uid: 15675 + components: + - type: Transform + pos: 1.5,36.5 + parent: 2 + - uid: 15676 + components: + - type: Transform + pos: 1.5,37.5 + parent: 2 + - uid: 15677 + components: + - type: Transform + pos: 1.5,38.5 + parent: 2 + - uid: 15678 + components: + - type: Transform + pos: 1.5,39.5 + parent: 2 + - uid: 15679 + components: + - type: Transform + pos: 1.5,40.5 + parent: 2 + - uid: 15680 + components: + - type: Transform + pos: 1.5,41.5 + parent: 2 + - uid: 15681 + components: + - type: Transform + pos: 2.5,37.5 + parent: 2 + - uid: 15682 + components: + - type: Transform + pos: 3.5,37.5 + parent: 2 + - uid: 15683 + components: + - type: Transform + pos: 4.5,37.5 + parent: 2 + - uid: 15684 + components: + - type: Transform + pos: 5.5,37.5 + parent: 2 + - uid: 15685 + components: + - type: Transform + pos: 6.5,37.5 + parent: 2 + - uid: 15686 + components: + - type: Transform + pos: 7.5,37.5 + parent: 2 + - uid: 15687 + components: + - type: Transform + pos: 8.5,37.5 + parent: 2 + - uid: 15688 + components: + - type: Transform + pos: 9.5,37.5 + parent: 2 + - uid: 15689 + components: + - type: Transform + pos: 10.5,37.5 + parent: 2 + - uid: 15690 + components: + - type: Transform + pos: 10.5,38.5 + parent: 2 + - uid: 15691 + components: + - type: Transform + pos: 10.5,39.5 + parent: 2 + - uid: 15692 + components: + - type: Transform + pos: 10.5,40.5 + parent: 2 + - uid: 15693 + components: + - type: Transform + pos: 10.5,41.5 + parent: 2 + - uid: 15694 + components: + - type: Transform + pos: 6.5,38.5 + parent: 2 + - uid: 15695 + components: + - type: Transform + pos: 6.5,39.5 + parent: 2 + - uid: 15696 + components: + - type: Transform + pos: 6.5,40.5 + parent: 2 + - uid: 15697 + components: + - type: Transform + pos: 6.5,41.5 + parent: 2 + - uid: 15698 + components: + - type: Transform + pos: 10.5,36.5 + parent: 2 + - uid: 15699 + components: + - type: Transform + pos: 10.5,35.5 + parent: 2 + - uid: 15700 + components: + - type: Transform + pos: 10.5,34.5 + parent: 2 + - uid: 15701 + components: + - type: Transform + pos: 10.5,33.5 + parent: 2 + - uid: 15702 + components: + - type: Transform + pos: 10.5,32.5 + parent: 2 + - uid: 15703 + components: + - type: Transform + pos: 9.5,32.5 + parent: 2 + - uid: 15704 + components: + - type: Transform + pos: 9.5,31.5 + parent: 2 + - uid: 15705 + components: + - type: Transform + pos: 9.5,30.5 + parent: 2 + - uid: 15706 + components: + - type: Transform + pos: 9.5,29.5 + parent: 2 + - uid: 15707 + components: + - type: Transform + pos: 8.5,30.5 + parent: 2 + - uid: 15708 + components: + - type: Transform + pos: 7.5,30.5 + parent: 2 + - uid: 15710 + components: + - type: Transform + pos: 5.5,30.5 + parent: 2 + - uid: 15714 + components: + - type: Transform + pos: 6.5,34.5 + parent: 2 + - uid: 15715 + components: + - type: Transform + pos: 5.5,31.5 + parent: 2 + - uid: 15716 + components: + - type: Transform + pos: 5.5,32.5 + parent: 2 + - uid: 15717 + components: + - type: Transform + pos: 5.5,33.5 + parent: 2 + - uid: 15718 + components: + - type: Transform + pos: 5.5,34.5 + parent: 2 + - uid: 15787 + components: + - type: Transform + pos: 6.5,30.5 + parent: 2 - proto: CableApcStack entities: - uid: 3104 @@ -22947,25 +24246,15 @@ entities: - type: Transform pos: 10.5,22.5 parent: 2 - - uid: 166 - components: - - type: Transform - pos: 13.5,21.5 - parent: 2 - uid: 169 components: - type: Transform pos: -30.5,-49.5 parent: 2 - - uid: 175 - components: - - type: Transform - pos: 13.5,13.5 - parent: 2 - uid: 179 components: - type: Transform - pos: 13.5,15.5 + pos: 14.5,15.5 parent: 2 - uid: 183 components: @@ -22977,11 +24266,6 @@ entities: - type: Transform pos: 8.5,22.5 parent: 2 - - uid: 255 - components: - - type: Transform - pos: 13.5,19.5 - parent: 2 - uid: 396 components: - type: Transform @@ -23032,6 +24316,11 @@ entities: - type: Transform pos: -28.5,-43.5 parent: 2 + - uid: 528 + components: + - type: Transform + pos: 14.5,13.5 + parent: 2 - uid: 576 components: - type: Transform @@ -23102,16 +24391,6 @@ entities: - type: Transform pos: -42.5,21.5 parent: 2 - - uid: 1879 - components: - - type: Transform - pos: 13.5,18.5 - parent: 2 - - uid: 1884 - components: - - type: Transform - pos: 13.5,20.5 - parent: 2 - uid: 1905 components: - type: Transform @@ -23147,21 +24426,6 @@ entities: - type: Transform pos: 13.5,12.5 parent: 2 - - uid: 2417 - components: - - type: Transform - pos: 13.5,16.5 - parent: 2 - - uid: 2418 - components: - - type: Transform - pos: 13.5,17.5 - parent: 2 - - uid: 2429 - components: - - type: Transform - pos: 13.5,14.5 - parent: 2 - uid: 2602 components: - type: Transform @@ -25147,11 +26411,6 @@ entities: - type: Transform pos: -1.5,12.5 parent: 2 - - uid: 5871 - components: - - type: Transform - pos: 0.5,29.5 - parent: 2 - uid: 5878 components: - type: Transform @@ -25207,16 +26466,6 @@ entities: - type: Transform pos: 0.5,28.5 parent: 2 - - uid: 5901 - components: - - type: Transform - pos: 0.5,30.5 - parent: 2 - - uid: 5902 - components: - - type: Transform - pos: 0.5,31.5 - parent: 2 - uid: 5904 components: - type: Transform @@ -25252,51 +26501,6 @@ entities: - type: Transform pos: 11.5,28.5 parent: 2 - - uid: 5911 - components: - - type: Transform - pos: 11.5,29.5 - parent: 2 - - uid: 5912 - components: - - type: Transform - pos: 11.5,30.5 - parent: 2 - - uid: 5913 - components: - - type: Transform - pos: 11.5,31.5 - parent: 2 - - uid: 5914 - components: - - type: Transform - pos: 11.5,32.5 - parent: 2 - - uid: 5915 - components: - - type: Transform - pos: 11.5,33.5 - parent: 2 - - uid: 5916 - components: - - type: Transform - pos: 10.5,33.5 - parent: 2 - - uid: 5917 - components: - - type: Transform - pos: 9.5,33.5 - parent: 2 - - uid: 5918 - components: - - type: Transform - pos: 8.5,33.5 - parent: 2 - - uid: 5919 - components: - - type: Transform - pos: 7.5,33.5 - parent: 2 - uid: 5920 components: - type: Transform @@ -28132,6 +29336,31 @@ entities: - type: Transform pos: -45.5,-17.5 parent: 2 + - uid: 13263 + components: + - type: Transform + pos: 14.5,16.5 + parent: 2 + - uid: 13264 + components: + - type: Transform + pos: 14.5,19.5 + parent: 2 + - uid: 13265 + components: + - type: Transform + pos: 14.5,18.5 + parent: 2 + - uid: 13266 + components: + - type: Transform + pos: 14.5,17.5 + parent: 2 + - uid: 13269 + components: + - type: Transform + pos: 14.5,21.5 + parent: 2 - uid: 13554 components: - type: Transform @@ -28157,6 +29386,11 @@ entities: - type: Transform pos: -49.5,9.5 parent: 2 + - uid: 14136 + components: + - type: Transform + pos: 14.5,20.5 + parent: 2 - uid: 14598 components: - type: Transform @@ -28172,6 +29406,271 @@ entities: - type: Transform pos: -37.5,14.5 parent: 2 + - uid: 14850 + components: + - type: Transform + pos: 14.5,22.5 + parent: 2 + - uid: 15018 + components: + - type: Transform + pos: 14.5,14.5 + parent: 2 + - uid: 15061 + components: + - type: Transform + pos: -49.5,21.5 + parent: 2 + - uid: 15062 + components: + - type: Transform + pos: -50.5,21.5 + parent: 2 + - uid: 15063 + components: + - type: Transform + pos: -51.5,21.5 + parent: 2 + - uid: 15064 + components: + - type: Transform + pos: -52.5,21.5 + parent: 2 + - uid: 15065 + components: + - type: Transform + pos: -53.5,21.5 + parent: 2 + - uid: 15077 + components: + - type: Transform + pos: -67.5,28.5 + parent: 2 + - uid: 15078 + components: + - type: Transform + pos: -68.5,28.5 + parent: 2 + - uid: 15079 + components: + - type: Transform + pos: -69.5,28.5 + parent: 2 + - uid: 15080 + components: + - type: Transform + pos: -70.5,28.5 + parent: 2 + - uid: 15081 + components: + - type: Transform + pos: -71.5,28.5 + parent: 2 + - uid: 15082 + components: + - type: Transform + pos: -72.5,28.5 + parent: 2 + - uid: 15083 + components: + - type: Transform + pos: -72.5,29.5 + parent: 2 + - uid: 15093 + components: + - type: Transform + pos: -72.5,30.5 + parent: 2 + - uid: 15094 + components: + - type: Transform + pos: -71.5,30.5 + parent: 2 + - uid: 15095 + components: + - type: Transform + pos: -70.5,30.5 + parent: 2 + - uid: 15096 + components: + - type: Transform + pos: -70.5,31.5 + parent: 2 + - uid: 15097 + components: + - type: Transform + pos: -70.5,32.5 + parent: 2 + - uid: 15098 + components: + - type: Transform + pos: -70.5,33.5 + parent: 2 + - uid: 15099 + components: + - type: Transform + pos: -70.5,34.5 + parent: 2 + - uid: 15100 + components: + - type: Transform + pos: -74.5,34.5 + parent: 2 + - uid: 15101 + components: + - type: Transform + pos: -74.5,33.5 + parent: 2 + - uid: 15102 + components: + - type: Transform + pos: -74.5,32.5 + parent: 2 + - uid: 15103 + components: + - type: Transform + pos: -74.5,31.5 + parent: 2 + - uid: 15104 + components: + - type: Transform + pos: -74.5,30.5 + parent: 2 + - uid: 15105 + components: + - type: Transform + pos: -73.5,30.5 + parent: 2 + - uid: 15218 + components: + - type: Transform + pos: 14.5,12.5 + parent: 2 + - uid: 15251 + components: + - type: Transform + pos: -71.5,25.5 + parent: 2 + - uid: 15254 + components: + - type: Transform + pos: -70.5,25.5 + parent: 2 + - uid: 15255 + components: + - type: Transform + pos: -72.5,27.5 + parent: 2 + - uid: 15265 + components: + - type: Transform + pos: -65.5,25.5 + parent: 2 + - uid: 15266 + components: + - type: Transform + pos: -63.5,25.5 + parent: 2 + - uid: 15267 + components: + - type: Transform + pos: -60.5,24.5 + parent: 2 + - uid: 15268 + components: + - type: Transform + pos: -60.5,22.5 + parent: 2 + - uid: 15270 + components: + - type: Transform + pos: -56.5,21.5 + parent: 2 + - uid: 15271 + components: + - type: Transform + pos: -59.5,21.5 + parent: 2 + - uid: 15273 + components: + - type: Transform + pos: -58.5,21.5 + parent: 2 + - uid: 15274 + components: + - type: Transform + pos: -54.5,21.5 + parent: 2 + - uid: 15279 + components: + - type: Transform + pos: -66.5,25.5 + parent: 2 + - uid: 15280 + components: + - type: Transform + pos: -61.5,25.5 + parent: 2 + - uid: 15282 + components: + - type: Transform + pos: -72.5,25.5 + parent: 2 + - uid: 15283 + components: + - type: Transform + pos: -69.5,25.5 + parent: 2 + - uid: 15284 + components: + - type: Transform + pos: -72.5,26.5 + parent: 2 + - uid: 15287 + components: + - type: Transform + pos: -67.5,25.5 + parent: 2 + - uid: 15288 + components: + - type: Transform + pos: -68.5,25.5 + parent: 2 + - uid: 15293 + components: + - type: Transform + pos: -64.5,25.5 + parent: 2 + - uid: 15294 + components: + - type: Transform + pos: -62.5,25.5 + parent: 2 + - uid: 15295 + components: + - type: Transform + pos: -60.5,23.5 + parent: 2 + - uid: 15296 + components: + - type: Transform + pos: -60.5,25.5 + parent: 2 + - uid: 15297 + components: + - type: Transform + pos: -60.5,21.5 + parent: 2 + - uid: 15298 + components: + - type: Transform + pos: -57.5,21.5 + parent: 2 + - uid: 15300 + components: + - type: Transform + pos: -55.5,21.5 + parent: 2 - proto: CableHVStack entities: - uid: 5710 @@ -28246,11 +29745,31 @@ entities: - type: Transform pos: -52.5,-13.5 parent: 2 + - uid: 1000 + components: + - type: Transform + pos: 5.5,31.5 + parent: 2 - uid: 1008 components: - type: Transform pos: -41.5,20.5 parent: 2 + - uid: 1114 + components: + - type: Transform + pos: 1.5,7.5 + parent: 2 + - uid: 1115 + components: + - type: Transform + pos: 2.5,7.5 + parent: 2 + - uid: 1116 + components: + - type: Transform + pos: 3.5,7.5 + parent: 2 - uid: 1132 components: - type: Transform @@ -28356,11 +29875,6 @@ entities: - type: Transform pos: 14.5,9.5 parent: 2 - - uid: 2194 - components: - - type: Transform - pos: -1.5,11.5 - parent: 2 - uid: 2217 components: - type: Transform @@ -30296,6 +31810,11 @@ entities: - type: Transform pos: -53.5,3.5 parent: 2 + - uid: 6669 + components: + - type: Transform + pos: -71.5,37.5 + parent: 2 - uid: 6671 components: - type: Transform @@ -30891,6 +32410,11 @@ entities: - type: Transform pos: -50.5,-10.5 parent: 2 + - uid: 8169 + components: + - type: Transform + pos: -71.5,31.5 + parent: 2 - uid: 8264 components: - type: Transform @@ -31511,6 +33035,21 @@ entities: - type: Transform pos: -39.5,-39.5 parent: 2 + - uid: 8737 + components: + - type: Transform + pos: -0.5,5.5 + parent: 2 + - uid: 8738 + components: + - type: Transform + pos: 0.5,7.5 + parent: 2 + - uid: 8739 + components: + - type: Transform + pos: -0.5,6.5 + parent: 2 - uid: 8757 components: - type: Transform @@ -32031,16 +33570,6 @@ entities: - type: Transform pos: -61.5,-19.5 parent: 2 - - uid: 13558 - components: - - type: Transform - pos: -1.5,10.5 - parent: 2 - - uid: 13559 - components: - - type: Transform - pos: -1.5,9.5 - parent: 2 - uid: 13560 components: - type: Transform @@ -32146,6 +33675,11 @@ entities: - type: Transform pos: 2.5,-10.5 parent: 2 + - uid: 14195 + components: + - type: Transform + pos: 0.5,5.5 + parent: 2 - uid: 14353 components: - type: Transform @@ -32176,6 +33710,226 @@ entities: - type: Transform pos: -37.5,14.5 parent: 2 + - uid: 14914 + components: + - type: Transform + pos: -71.5,30.5 + parent: 2 + - uid: 14982 + components: + - type: Transform + pos: -71.5,29.5 + parent: 2 + - uid: 15016 + components: + - type: Transform + pos: -72.5,38.5 + parent: 2 + - uid: 15017 + components: + - type: Transform + pos: -72.5,37.5 + parent: 2 + - uid: 15021 + components: + - type: Transform + pos: -72.5,33.5 + parent: 2 + - uid: 15022 + components: + - type: Transform + pos: -72.5,32.5 + parent: 2 + - uid: 15023 + components: + - type: Transform + pos: -72.5,31.5 + parent: 2 + - uid: 15073 + components: + - type: Transform + pos: -71.5,36.5 + parent: 2 + - uid: 15074 + components: + - type: Transform + pos: -71.5,35.5 + parent: 2 + - uid: 15075 + components: + - type: Transform + pos: -71.5,34.5 + parent: 2 + - uid: 15085 + components: + - type: Transform + pos: -70.5,29.5 + parent: 2 + - uid: 15086 + components: + - type: Transform + pos: -69.5,29.5 + parent: 2 + - uid: 15087 + components: + - type: Transform + pos: -68.5,29.5 + parent: 2 + - uid: 15088 + components: + - type: Transform + pos: -67.5,29.5 + parent: 2 + - uid: 15089 + components: + - type: Transform + pos: -67.5,28.5 + parent: 2 + - uid: 15106 + components: + - type: Transform + pos: -74.5,33.5 + parent: 2 + - uid: 15107 + components: + - type: Transform + pos: -73.5,33.5 + parent: 2 + - uid: 15108 + components: + - type: Transform + pos: -70.5,33.5 + parent: 2 + - uid: 15109 + components: + - type: Transform + pos: -71.5,33.5 + parent: 2 + - uid: 15653 + components: + - type: Transform + pos: -0.5,7.5 + parent: 2 + - uid: 15711 + components: + - type: Transform + pos: 4.5,31.5 + parent: 2 + - uid: 15712 + components: + - type: Transform + pos: 4.5,29.5 + parent: 2 + - uid: 15713 + components: + - type: Transform + pos: 4.5,30.5 + parent: 2 + - uid: 15719 + components: + - type: Transform + pos: 3.5,33.5 + parent: 2 + - uid: 15729 + components: + - type: Transform + pos: 3.5,31.5 + parent: 2 + - uid: 15730 + components: + - type: Transform + pos: 3.5,34.5 + parent: 2 + - uid: 15731 + components: + - type: Transform + pos: 3.5,35.5 + parent: 2 + - uid: 15732 + components: + - type: Transform + pos: 3.5,36.5 + parent: 2 + - uid: 15733 + components: + - type: Transform + pos: 4.5,36.5 + parent: 2 + - uid: 15734 + components: + - type: Transform + pos: 5.5,36.5 + parent: 2 + - uid: 15735 + components: + - type: Transform + pos: 6.5,36.5 + parent: 2 + - uid: 15736 + components: + - type: Transform + pos: 7.5,36.5 + parent: 2 + - uid: 15737 + components: + - type: Transform + pos: 8.5,36.5 + parent: 2 + - uid: 15738 + components: + - type: Transform + pos: 8.5,35.5 + parent: 2 + - uid: 15739 + components: + - type: Transform + pos: 8.5,34.5 + parent: 2 + - uid: 15740 + components: + - type: Transform + pos: 8.5,31.5 + parent: 2 + - uid: 15741 + components: + - type: Transform + pos: 9.5,33.5 + parent: 2 + - uid: 15742 + components: + - type: Transform + pos: 2.5,33.5 + parent: 2 + - uid: 15744 + components: + - type: Transform + pos: 3.5,32.5 + parent: 2 + - uid: 15747 + components: + - type: Transform + pos: 8.5,33.5 + parent: 2 + - uid: 15748 + components: + - type: Transform + pos: 8.5,32.5 + parent: 2 + - uid: 15750 + components: + - type: Transform + pos: 7.5,31.5 + parent: 2 + - uid: 15752 + components: + - type: Transform + pos: 6.5,31.5 + parent: 2 + - uid: 15934 + components: + - type: Transform + pos: 4.5,7.5 + parent: 2 - proto: CableMVStack entities: - uid: 8114 @@ -32235,6 +33989,12 @@ entities: rot: -1.5707963267948966 rad pos: -64.5,-37.5 parent: 2 + - uid: 15084 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -69.5,28.5 + parent: 2 - proto: CannabisSeeds entities: - uid: 6593 @@ -32242,6 +34002,13 @@ entities: - type: Transform pos: -20.698257,-11.269745 parent: 2 + - uid: 15649 + components: + - type: Transform + parent: 15640 + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: CapacitorStockPart entities: - uid: 296 @@ -32304,6 +34071,11 @@ entities: - type: Transform pos: -5.3768744,19.42265 parent: 2 + - uid: 15652 + components: + - type: Transform + pos: 4.2787213,42.363914 + parent: 2 - proto: CardBag52 entities: - uid: 8811 @@ -32311,6 +34083,11 @@ entities: - type: Transform pos: -26.703133,-27.592596 parent: 2 + - uid: 11520 + components: + - type: Transform + pos: 4.31801,42.3074 + parent: 2 - proto: Carpet entities: - uid: 71 @@ -33037,11 +34814,29 @@ entities: rot: -1.5707963267948966 rad pos: -44.5,12.5 parent: 2 + - uid: 6099 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -56.5,29.5 + parent: 2 + - uid: 6100 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -56.5,28.5 + parent: 2 - uid: 6102 components: - type: Transform pos: -39.5,35.5 parent: 2 + - uid: 6190 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -56.5,31.5 + parent: 2 - uid: 6228 components: - type: Transform @@ -33288,6 +35083,12 @@ entities: - type: Transform pos: -15.5,-5.5 parent: 2 + - uid: 6858 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -56.5,30.5 + parent: 2 - uid: 6990 components: - type: Transform @@ -34446,36 +36247,6 @@ entities: - type: Transform pos: 13.5,22.5 parent: 2 - - uid: 9328 - components: - - type: Transform - pos: 13.5,20.5 - parent: 2 - - uid: 9329 - components: - - type: Transform - pos: 13.5,19.5 - parent: 2 - - uid: 9330 - components: - - type: Transform - pos: 13.5,18.5 - parent: 2 - - uid: 9331 - components: - - type: Transform - pos: 13.5,17.5 - parent: 2 - - uid: 9332 - components: - - type: Transform - pos: 13.5,16.5 - parent: 2 - - uid: 9333 - components: - - type: Transform - pos: 13.5,15.5 - parent: 2 - uid: 9334 components: - type: Transform @@ -34501,11 +36272,6 @@ entities: - type: Transform pos: 18.5,19.5 parent: 2 - - uid: 9339 - components: - - type: Transform - pos: 13.5,13.5 - parent: 2 - uid: 9340 components: - type: Transform @@ -36802,6 +38568,230 @@ entities: - type: Transform pos: -55.5,24.5 parent: 2 + - uid: 14702 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -52.5,17.5 + parent: 2 + - uid: 14851 + components: + - type: Transform + pos: 14.5,15.5 + parent: 2 + - uid: 15056 + components: + - type: Transform + pos: -56.5,21.5 + parent: 2 + - uid: 15059 + components: + - type: Transform + pos: 14.5,20.5 + parent: 2 + - uid: 15060 + components: + - type: Transform + pos: 14.5,18.5 + parent: 2 + - uid: 15066 + components: + - type: Transform + pos: 14.5,19.5 + parent: 2 + - uid: 15128 + components: + - type: Transform + pos: 14.5,17.5 + parent: 2 + - uid: 15130 + components: + - type: Transform + pos: 14.5,16.5 + parent: 2 + - uid: 15143 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -74.5,29.5 + parent: 2 + - uid: 15172 + components: + - type: Transform + pos: -55.5,21.5 + parent: 2 + - uid: 15173 + components: + - type: Transform + pos: -57.5,21.5 + parent: 2 + - uid: 15174 + components: + - type: Transform + pos: -58.5,21.5 + parent: 2 + - uid: 15175 + components: + - type: Transform + pos: -59.5,21.5 + parent: 2 + - uid: 15176 + components: + - type: Transform + pos: -60.5,21.5 + parent: 2 + - uid: 15177 + components: + - type: Transform + pos: -60.5,22.5 + parent: 2 + - uid: 15178 + components: + - type: Transform + pos: -60.5,23.5 + parent: 2 + - uid: 15179 + components: + - type: Transform + pos: -60.5,24.5 + parent: 2 + - uid: 15180 + components: + - type: Transform + pos: -60.5,25.5 + parent: 2 + - uid: 15181 + components: + - type: Transform + pos: -72.5,25.5 + parent: 2 + - uid: 15182 + components: + - type: Transform + pos: -71.5,25.5 + parent: 2 + - uid: 15184 + components: + - type: Transform + pos: -77.5,26.5 + parent: 2 + - uid: 15185 + components: + - type: Transform + pos: -77.5,25.5 + parent: 2 + - uid: 15186 + components: + - type: Transform + pos: -77.5,24.5 + parent: 2 + - uid: 15187 + components: + - type: Transform + pos: -76.5,26.5 + parent: 2 + - uid: 15188 + components: + - type: Transform + pos: -76.5,25.5 + parent: 2 + - uid: 15189 + components: + - type: Transform + pos: -76.5,24.5 + parent: 2 + - uid: 15190 + components: + - type: Transform + pos: -75.5,26.5 + parent: 2 + - uid: 15191 + components: + - type: Transform + pos: -75.5,25.5 + parent: 2 + - uid: 15192 + components: + - type: Transform + pos: -75.5,24.5 + parent: 2 + - uid: 15198 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -73.5,29.5 + parent: 2 + - uid: 15199 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -71.5,29.5 + parent: 2 + - uid: 15217 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -70.5,29.5 + parent: 2 + - uid: 15223 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -68.5,36.5 + parent: 2 + - uid: 15224 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -69.5,36.5 + parent: 2 + - uid: 15225 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -76.5,36.5 + parent: 2 + - uid: 15226 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -75.5,36.5 + parent: 2 + - uid: 15227 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -76.5,35.5 + parent: 2 + - uid: 15248 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -53.5,17.5 + parent: 2 + - uid: 15252 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -56.5,17.5 + parent: 2 + - uid: 15253 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -55.5,17.5 + parent: 2 + - uid: 15281 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -56.5,18.5 + parent: 2 + - uid: 15615 + components: + - type: Transform + pos: -68.5,35.5 + parent: 2 - proto: CentcomHampter entities: - uid: 13156 @@ -36870,11 +38860,6 @@ entities: - type: Transform pos: -60.5,-4.5 parent: 2 - - uid: 5838 - components: - - type: Transform - pos: 5.5,31.5 - parent: 2 - uid: 6543 components: - type: Transform @@ -37074,6 +39059,12 @@ entities: - type: Transform pos: -40.5,-9.5 parent: 2 + - uid: 8744 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -0.5,14.5 + parent: 2 - uid: 8885 components: - type: Transform @@ -37185,6 +39176,12 @@ entities: rot: 1.5707963267948966 rad pos: 0.5,-15.5 parent: 2 + - uid: 11600 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 5.5,42.5 + parent: 2 - uid: 12836 components: - type: Transform @@ -37203,6 +39200,24 @@ entities: rot: 3.141592653589793 rad pos: -61.5,-15.5 parent: 2 + - uid: 15231 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -0.5,15.5 + parent: 2 + - uid: 15614 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 6.5,41.5 + parent: 2 + - uid: 15628 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 7.5,41.5 + parent: 2 - proto: ChairFolding entities: - uid: 6546 @@ -37316,6 +39331,12 @@ entities: rot: 3.141592653589793 rad pos: -64.52679,-32.33668 parent: 2 + - uid: 11636 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 6.5,34.5 + parent: 2 - uid: 13213 components: - type: Transform @@ -37328,6 +39349,12 @@ entities: rot: 3.141592653589793 rad pos: -10.5,20.5 parent: 2 + - uid: 15950 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 1.5326643,15.692835 + parent: 2 - proto: ChairOfficeLight entities: - uid: 416 @@ -37476,24 +39503,12 @@ entities: parent: 2 - proto: CheapLighter entities: - - uid: 1120 - components: - - type: Transform - parent: 596 - - type: Physics - canCollide: False - uid: 4717 components: - type: Transform rot: 1.5707963267948966 rad pos: -7.352806,-14.377692 parent: 2 - - uid: 12708 - components: - - type: Transform - parent: 12702 - - type: Physics - canCollide: False - proto: CheckerBoard entities: - uid: 5622 @@ -37544,6 +39559,11 @@ entities: - type: Transform pos: -27.452692,-27.429317 parent: 2 + - uid: 11590 + components: + - type: Transform + pos: 6.401253,42.613335 + parent: 2 - proto: Cigarette entities: - uid: 8080 @@ -37618,14 +39638,17 @@ entities: - type: Transform pos: -30.646751,5.629158 parent: 2 -- proto: CigPackBlack +- proto: CigCartonBlack entities: - - uid: 1118 + - uid: 5739 components: - type: Transform - parent: 596 + parent: 15630 - type: Physics canCollide: False + - type: InsideEntityStorage +- proto: CigPackBlack + entities: - uid: 5576 components: - type: Transform @@ -37637,12 +39660,6 @@ entities: rot: 1.5707963267948966 rad pos: -7.675968,-14.141944 parent: 2 - - uid: 12707 - components: - - type: Transform - parent: 12702 - - type: Physics - canCollide: False - proto: CigPackGreen entities: - uid: 7976 @@ -37807,6 +39824,11 @@ entities: - type: Transform pos: -41.5,18.5 parent: 2 + - uid: 15327 + components: + - type: Transform + pos: -53.5,18.5 + parent: 2 - proto: ClosetFireFilled entities: - uid: 1332 @@ -37917,8 +39939,8 @@ entities: immutable: False temperature: 293.14673 moles: - - 1.7459903 - - 6.568249 + - 1.8856695 + - 7.0937095 - 0 - 0 - 0 @@ -37943,6 +39965,7 @@ entities: showEnts: False occludes: True ents: + - 8147 - 5637 - 5692 - 5703 @@ -38086,6 +40109,11 @@ entities: - type: Transform pos: -45.5,-21.5 parent: 2 + - uid: 15336 + components: + - type: Transform + pos: -52.5,18.5 + parent: 2 - proto: ClosetRadiationSuitFilled entities: - uid: 372 @@ -38113,6 +40141,21 @@ entities: - type: Transform pos: -36.5,10.5 parent: 2 + - uid: 14980 + components: + - type: Transform + pos: -61.5,26.5 + parent: 2 + - uid: 15140 + components: + - type: Transform + pos: -60.5,26.5 + parent: 2 + - uid: 15151 + components: + - type: Transform + pos: -59.5,26.5 + parent: 2 - proto: ClosetToolFilled entities: - uid: 6308 @@ -38145,11 +40188,6 @@ entities: - type: Transform pos: -15.5,5.5 parent: 2 - - uid: 9522 - components: - - type: Transform - pos: 14.5,16.5 - parent: 2 - uid: 9584 components: - type: Transform @@ -38270,13 +40308,6 @@ entities: component: Armor title: null - type: InsideEntityStorage -- proto: ClothingBeltJanitorFilled - entities: - - uid: 8290 - components: - - type: Transform - pos: 16.325048,15.43998 - parent: 2 - proto: ClothingBeltMedicalRig entities: - uid: 1870 @@ -38286,6 +40317,31 @@ entities: - type: Physics canCollide: False - type: InsideEntityStorage +- proto: ClothingBeltMilitaryWebbing + entities: + - uid: 1772 + components: + - type: Transform + parent: 1019 + - type: Physics + canCollide: False + - type: GroupExamine + group: + - hoverMessage: "" + contextText: verb-examine-group-other + icon: /Textures/Interface/examine-star.png + components: + - Armor + - ClothingSpeedModifier + entries: + - message: >- + Обеспечивает следующую защиту: + + - [color=orange]Explosion[/color] damage [color=white]to contents[/color] reduced by [color=lightblue]50%[/color]. + priority: 0 + component: Armor + title: null + - type: InsideEntityStorage - proto: ClothingBeltSalvageWebbing entities: - uid: 7057 @@ -38493,6 +40549,13 @@ entities: - type: Transform pos: -34.54493,-42.307037 parent: 2 +- proto: ClothingHeadBandSkull + entities: + - uid: 15671 + components: + - type: Transform + pos: 9.620365,42.3696 + parent: 2 - proto: ClothingHeadCapInspector entities: - uid: 14282 @@ -38674,15 +40737,6 @@ entities: - type: Physics canCollide: False - type: InsideEntityStorage -- proto: ClothingHeadHatRedsoft - entities: - - uid: 14821 - components: - - type: Transform - parent: 14820 - - type: Physics - canCollide: False - - type: InsideEntityStorage - proto: ClothingHeadHatSurgcapBlue entities: - uid: 6963 @@ -38695,15 +40749,13 @@ entities: - type: Transform pos: 0.6419029,-9.335557 parent: 2 -- proto: ClothingHeadHatSyndie +- proto: ClothingHeadHatUshanka entities: - - uid: 8172 + - uid: 15531 components: - type: Transform - parent: 8171 - - type: Physics - canCollide: False - - type: InsideEntityStorage + pos: -61.07476,34.467327 + parent: 2 - proto: ClothingHeadHatWarden entities: - uid: 8094 @@ -38762,17 +40814,17 @@ entities: - type: InsideEntityStorage - proto: ClothingHeadHelmetRiot entities: - - uid: 208 + - uid: 15208 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 213 + - uid: 15210 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage @@ -38823,18 +40875,6 @@ entities: - type: Transform pos: -13.687558,-53.26162 parent: 2 - - uid: 12604 - components: - - type: Transform - pos: 0.7936738,36.78535 - parent: 2 -- proto: ClothingMaskClown - entities: - - uid: 13151 - components: - - type: Transform - pos: 7.5169325,34.568058 - parent: 2 - proto: ClothingMaskMuzzle entities: - uid: 14414 @@ -38874,10 +40914,10 @@ entities: parent: 2 - proto: ClothingNeckScarfStripedSyndieRed entities: - - uid: 14822 + - uid: 1031 components: - type: Transform - parent: 14820 + parent: 1019 - type: Physics canCollide: False - type: InsideEntityStorage @@ -38906,63 +40946,63 @@ entities: - type: InsideEntityStorage - proto: ClothingOuterArmorBulletproof entities: - - uid: 237 + - uid: 15211 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 239 + - uid: 15212 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 242 + - uid: 15214 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage - proto: ClothingOuterArmorReflective entities: - - uid: 210 + - uid: 15205 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 215 + - uid: 15206 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 244 + - uid: 15207 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage - proto: ClothingOuterArmorRiot entities: - - uid: 232 + - uid: 15213 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 234 + - uid: 15215 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage @@ -38991,6 +41031,53 @@ entities: - type: Physics canCollide: False - type: InsideEntityStorage +- proto: ClothingOuterHardsuitAtmos + entities: + - uid: 12237 + components: + - type: Transform + parent: 14573 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 14092 + components: + - type: Transform + parent: 14634 + - type: GroupExamine + group: + - hoverMessage: "" + contextText: verb-examine-group-other + icon: /Textures/Interface/examine-star.png + components: + - Armor + - ClothingSpeedModifier + entries: + - message: Понижает вашу скорость на [color=yellow]15%[/color]. + priority: 0 + component: ClothingSpeedModifier + - message: >- + Обеспечивает следующую защиту: + + - [color=yellow]Тупой[/color] урон снижается на [color=lightblue]10%[/color]. + + - [color=yellow]Рубящий[/color] урон снижается на [color=lightblue]10%[/color]. + + - [color=yellow]Проникающий[/color] урон снижается на [color=lightblue]10%[/color]. + + - [color=yellow]Тепловой[/color] урон снижается на [color=lightblue]80%[/color]. + + - [color=yellow]Радиационный[/color] урон снижается на [color=lightblue]50%[/color]. + + - [color=yellow]Кислотный[/color] урон снижается на [color=lightblue]50%[/color]. + + - [color=orange]Взрывной[/color] урон снижен благодаря [color=lightblue]50%[/color]. + priority: 0 + component: Armor + title: null + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: ClothingOuterHardsuitEVA entities: - uid: 8291 @@ -39009,31 +41096,31 @@ entities: - type: InsideEntityStorage - proto: ClothingOuterHardsuitSecurity entities: - - uid: 5638 + - uid: 15201 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 5641 + - uid: 15202 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 5643 + - uid: 15203 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 5749 + - uid: 15216 components: - type: Transform - parent: 5713 + parent: 15200 - type: Physics canCollide: False - type: InsideEntityStorage @@ -39098,10 +41185,10 @@ entities: parent: 2 - proto: ClothingOuterSuitEmergency entities: - - uid: 14294 + - uid: 15920 components: - type: Transform - pos: 0.4877944,36.483643 + pos: 3.5060701,46.52745 parent: 2 - proto: ClothingOuterTrenchCoatInspector entities: @@ -39242,40 +41329,84 @@ entities: - type: InsideEntityStorage - proto: ClothingShoesBootsMagSyndie entities: - - uid: 14824 + - uid: 1033 components: - type: Transform - parent: 14820 - - type: Magboots - toggleActionEntity: 14827 - - type: GasTank - toggleActionEntity: 14826 - - type: Jetpack - toggleActionEntity: 14825 + parent: 1019 - type: Physics canCollide: False - - type: ActionsContainer - - type: ContainerContainer - containers: - actions: !type:Container - ents: - - 14825 - - 14826 - - 14827 - type: InsideEntityStorage -- proto: ClothingShoesClown +- proto: ClothingShoesColorBlack entities: - - uid: 13152 + - uid: 15631 components: - type: Transform - pos: 7.4809732,34.262302 - parent: 2 + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15632 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15633 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15634 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15635 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15636 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15637 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15638 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15639 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: ClothingShoesGaloshes entities: - uid: 8281 components: - type: Transform - pos: 16.613014,15.356045 + pos: 16.66545,15.385233 parent: 2 - proto: ClothingShoesSkatesReider207 entities: @@ -39348,6 +41479,15 @@ entities: - type: Physics canCollide: False - type: InsideEntityStorage +- proto: ClothingUniformJumpskirtTacticool + entities: + - uid: 1768 + components: + - type: Transform + parent: 1019 + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: ClothingUniformJumpsuitAncient entities: - uid: 2123 @@ -39355,15 +41495,65 @@ entities: - type: Transform pos: -30.906902,2.333919 parent: 2 -- proto: ClothingUniformJumpsuitPyjamaSyndicateRed +- proto: ClothingUniformJumpsuitPrisoner entities: - - uid: 14823 + - uid: 12696 components: + - type: MetaData + name: комбинезон заключенного (ТРЕТИЙ) - type: Transform - parent: 14820 + parent: 609 - type: Physics canCollide: False - type: InsideEntityStorage + - uid: 12700 + components: + - type: MetaData + name: комбинезон заключенного (ВТОРОЙ) + - type: Transform + parent: 885 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 12701 + components: + - type: MetaData + name: комбинезон заключенного (ПЕРВЫЙ) + - type: Transform + parent: 937 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 12702 + components: + - type: MetaData + name: комбинезон заключенного (ЧЕТВЕРТЫЙ) + - type: Transform + parent: 4442 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 12708 + components: + - type: MetaData + name: комбинезон заключенного (ПЕРМА) + - type: Transform + pos: 8.332919,29.628994 + parent: 2 + - uid: 15967 + components: + - type: MetaData + name: комбинезон заключенного (ПЕРМА) + - type: Transform + pos: 8.623373,29.562729 + parent: 2 + - uid: 15968 + components: + - type: MetaData + name: комбинезон заключенного (ПЕРМА) + - type: Transform + pos: 8.427637,29.429789 + parent: 2 - proto: ClothingUniformJumpsuitReporter entities: - uid: 9040 @@ -39373,6 +41563,15 @@ entities: - type: Physics canCollide: False - type: InsideEntityStorage +- proto: ClothingUniformJumpsuitTacticool + entities: + - uid: 1674 + components: + - type: Transform + parent: 1019 + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: ClownRecorder entities: - uid: 8987 @@ -39380,6 +41579,13 @@ entities: - type: Transform pos: 8.732734,-19.329597 parent: 2 +- proto: CombatKnife + entities: + - uid: 15969 + components: + - type: Transform + pos: 7.5177975,35.283455 + parent: 2 - proto: ComfyChair entities: - uid: 2152 @@ -39627,6 +41833,12 @@ entities: - type: Transform pos: -40.5,22.5 parent: 2 + - uid: 15138 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -73.5,25.5 + parent: 2 - proto: ComputerAnalysisConsole entities: - uid: 1515 @@ -39717,6 +41929,11 @@ entities: rot: 3.141592653589793 rad pos: -26.5,-20.5 parent: 2 + - uid: 5847 + components: + - type: Transform + pos: 6.5,35.5 + parent: 2 - uid: 8408 components: - type: Transform @@ -39819,6 +42036,12 @@ entities: rot: -1.5707963267948966 rad pos: -33.5,28.5 parent: 2 + - uid: 15142 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -73.5,26.5 + parent: 2 - proto: ComputerRadar entities: - uid: 5450 @@ -39948,6 +42171,11 @@ entities: - type: Transform pos: -26.5,-18.5 parent: 2 + - uid: 12604 + components: + - type: Transform + pos: 5.5,35.5 + parent: 2 - uid: 13044 components: - type: Transform @@ -40234,51 +42462,13 @@ entities: showEnts: False occludes: True ent: null - - uid: 14820 +- proto: CrateEmergencyRadiation + entities: + - uid: 15055 components: - type: Transform - pos: 14.5,-8.5 + pos: -70.5,24.5 parent: 2 - - type: EntityStorage - air: - volume: 200 - immutable: False - temperature: 293.14673 - moles: - - 1.7459903 - - 6.568249 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - type: ContainerContainer - containers: - entity_storage: !type:Container - showEnts: False - occludes: True - ents: - - 14821 - - 14822 - - 14823 - - 14824 - paper_label: !type:ContainerSlot - showEnts: False - occludes: True - ent: null - proto: CrateEmptySpawner entities: - uid: 3351 @@ -40526,10 +42716,10 @@ entities: - 0 - proto: CrateNPCCow entities: - - uid: 7 + - uid: 9094 components: - type: Transform - pos: -16.5,-12.5 + pos: -15.5,-15.5 parent: 2 - proto: CrateNPCHamlet entities: @@ -40538,6 +42728,63 @@ entities: - type: Transform pos: -11.5,19.5 parent: 2 +- proto: CrateSecgear + entities: + - uid: 15720 + components: + - type: Transform + pos: 4.5,33.5 + parent: 2 + - type: EntityStorage + air: + volume: 200 + immutable: False + temperature: 293.1462 + moles: + - 1.606311 + - 6.042789 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - type: ContainerContainer + containers: + entity_storage: !type:Container + showEnts: False + occludes: True + ents: + - 15721 + - 15722 + - 15723 + - 15724 + - 15725 + - 15726 + - 15727 + - 15728 + - 5740 + - 5787 + - 5788 + - 5789 + - 5790 + - 5791 + paper_label: !type:ContainerSlot + showEnts: False + occludes: True + ent: null - proto: CrateServiceGuidebooks entities: - uid: 9526 @@ -40592,6 +42839,16 @@ entities: parent: 2 - proto: CryogenicSleepUnit entities: + - uid: 343 + components: + - type: Transform + pos: 2.5,35.5 + parent: 2 + - uid: 409 + components: + - type: Transform + pos: 2.5,34.5 + parent: 2 - uid: 8238 components: - type: Transform @@ -40888,13 +43145,6 @@ entities: - type: Transform pos: -38.5,-16.5 parent: 2 -- proto: DefaultStationBeaconPermaBrig - entities: - - uid: 12359 - components: - - type: Transform - pos: 5.5,29.5 - parent: 2 - proto: DefaultStationBeaconQMRoom entities: - uid: 12360 @@ -41020,25 +43270,30 @@ entities: parent: 2 - proto: DeployableBarrier entities: - - uid: 361 + - uid: 342 components: - type: Transform - pos: 4.5,6.5 + pos: -0.5,11.5 parent: 2 - - uid: 5691 + - uid: 423 components: - type: Transform - pos: 3.5,6.5 + pos: 1.5,11.5 parent: 2 - - uid: 5693 + - uid: 14196 components: - type: Transform - pos: 10.5,18.5 + pos: -0.5,10.5 parent: 2 - - uid: 12919 + - uid: 15238 components: - type: Transform - pos: 10.5,16.5 + pos: 7.5,16.5 + parent: 2 + - uid: 15947 + components: + - type: Transform + pos: 0.5,11.5 parent: 2 - proto: DiceBag entities: @@ -41052,6 +43307,11 @@ entities: - type: Transform pos: -26.535767,-28.233362 parent: 2 + - uid: 15626 + components: + - type: Transform + pos: 4.704021,42.334198 + parent: 2 - proto: DiseaseDiagnoser entities: - uid: 5002 @@ -41061,6 +43321,11 @@ entities: parent: 2 - proto: DisposalBend entities: + - uid: 6332 + components: + - type: Transform + pos: 3.5,9.5 + parent: 2 - uid: 6363 components: - type: Transform @@ -41283,11 +43548,6 @@ entities: rot: 3.141592653589793 rad pos: 3.5,7.5 parent: 2 - - uid: 14191 - components: - - type: Transform - pos: 3.5,12.5 - parent: 2 - uid: 14201 components: - type: Transform @@ -41335,6 +43595,17 @@ entities: rot: 1.5707963267948966 rad pos: -9.5,-25.5 parent: 2 + - uid: 15923 + components: + - type: Transform + pos: 4.5,38.5 + parent: 2 + - uid: 15924 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 3.5,38.5 + parent: 2 - proto: DisposalJunction entities: - uid: 1877 @@ -41525,6 +43796,12 @@ entities: rot: 3.141592653589793 rad pos: -58.5,-19.5 parent: 2 + - uid: 2532 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 3.5,32.5 + parent: 2 - uid: 2551 components: - type: Transform @@ -41591,12 +43868,24 @@ entities: rot: -1.5707963267948966 rad pos: -82.5,-34.5 parent: 2 + - uid: 4443 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 2.5,32.5 + parent: 2 - uid: 5481 components: - type: Transform rot: -1.5707963267948966 rad pos: -71.5,-34.5 parent: 2 + - uid: 5865 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 4.5,36.5 + parent: 2 - uid: 6368 components: - type: Transform @@ -43536,24 +45825,6 @@ entities: rot: 3.141592653589793 rad pos: 3.5,8.5 parent: 2 - - uid: 14194 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 3.5,9.5 - parent: 2 - - uid: 14195 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 3.5,10.5 - parent: 2 - - uid: 14196 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 3.5,11.5 - parent: 2 - uid: 14198 components: - type: Transform @@ -43803,6 +46074,12 @@ entities: - type: Transform pos: -9.5,-27.5 parent: 2 + - uid: 15922 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 4.5,37.5 + parent: 2 - proto: DisposalTrunk entities: - uid: 290 @@ -43811,6 +46088,12 @@ entities: rot: 3.141592653589793 rad pos: -51.5,-2.5 parent: 2 + - uid: 4445 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 4.5,32.5 + parent: 2 - uid: 6714 components: - type: Transform @@ -43823,6 +46106,12 @@ entities: rot: 1.5707963267948966 rad pos: -30.5,-12.5 parent: 2 + - uid: 8452 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 2.5,9.5 + parent: 2 - uid: 11284 components: - type: Transform @@ -43835,6 +46124,12 @@ entities: rot: 1.5707963267948966 rad pos: -87.5,-34.5 parent: 2 + - uid: 12566 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 4.5,35.5 + parent: 2 - uid: 13691 components: - type: Transform @@ -43959,12 +46254,6 @@ entities: rot: -1.5707963267948966 rad pos: -58.5,-3.5 parent: 2 - - uid: 14197 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 2.5,12.5 - parent: 2 - uid: 14206 components: - type: Transform @@ -43991,6 +46280,11 @@ entities: parent: 2 - proto: DisposalUnit entities: + - uid: 948 + components: + - type: Transform + pos: 4.5,32.5 + parent: 2 - uid: 3638 components: - type: Transform @@ -44006,10 +46300,10 @@ entities: - type: Transform pos: -12.5,12.5 parent: 2 - - uid: 5709 + - uid: 5846 components: - type: Transform - pos: 2.5,12.5 + pos: 4.5,35.5 parent: 2 - uid: 6305 components: @@ -44141,6 +46435,11 @@ entities: - type: Transform pos: -39.5,20.5 parent: 2 + - uid: 15989 + components: + - type: Transform + pos: 2.5,9.5 + parent: 2 - proto: DisposalYJunction entities: - uid: 301 @@ -44205,11 +46504,6 @@ entities: - type: Transform pos: -15.5,10.5 parent: 2 - - uid: 5601 - components: - - type: Transform - pos: -15.5,10.5 - parent: 2 - proto: DresserChiefEngineerFilled entities: - uid: 6371 @@ -44427,10 +46721,15 @@ entities: parent: 2 - proto: DrinkMilkCarton entities: + - uid: 994 + components: + - type: Transform + pos: -0.013669491,36.614845 + parent: 2 - uid: 6708 components: - type: Transform - pos: -17.878057,-15.118343 + pos: -16.878538,-13.458822 parent: 2 - uid: 9056 components: @@ -44440,22 +46739,89 @@ entities: - uid: 13387 components: - type: Transform - pos: -17.916197,-15.330967 + pos: -16.8869,-13.195456 parent: 2 -- proto: DrinkMugMetal + - uid: 15645 + components: + - type: Transform + parent: 15640 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15647 + components: + - type: Transform + parent: 15640 + - type: Physics + canCollide: False + - type: InsideEntityStorage +- proto: DrinkMREFlask entities: + - uid: 1117 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 1118 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage - uid: 1119 components: - type: Transform - parent: 596 + parent: 15630 - type: Physics canCollide: False - - uid: 12709 + - type: InsideEntityStorage + - uid: 1120 components: - type: Transform - parent: 12702 + parent: 15630 - type: Physics canCollide: False + - type: InsideEntityStorage + - uid: 1903 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 1995 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 2071 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 5733 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 5738 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage +- proto: DrinkMugMetal + entities: - uid: 12842 components: - type: Transform @@ -44466,6 +46832,21 @@ entities: - type: Transform pos: -30.444746,11.496373 parent: 2 + - uid: 15655 + components: + - type: Transform + pos: 7.6545677,42.455326 + parent: 2 + - uid: 15656 + components: + - type: Transform + pos: 7.0649214,42.674362 + parent: 2 + - uid: 15658 + components: + - type: Transform + pos: 7.293431,42.422215 + parent: 2 - proto: DrinkRumBottleFull entities: - uid: 5613 @@ -44505,6 +46886,13 @@ entities: - type: Transform pos: 4.4720497,-4.4298997 parent: 2 +- proto: DrinkTeapot + entities: + - uid: 558 + components: + - type: Transform + pos: 7.6197658,42.89484 + parent: 2 - proto: DrinkTequilaSunriseGlass entities: - uid: 6382 @@ -44519,6 +46907,13 @@ entities: - type: Transform pos: -36.509956,-51.679047 parent: 2 +- proto: DrinkVodkaBottleFull + entities: + - uid: 15530 + components: + - type: Transform + pos: -60.242645,33.324757 + parent: 2 - proto: DrinkWaterBottleFull entities: - uid: 8523 @@ -44589,12 +46984,6 @@ entities: rot: -1.5707963267948966 rad pos: 6.5,19.5 parent: 2 - - uid: 12566 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 7.5,29.5 - parent: 2 - uid: 12569 components: - type: Transform @@ -44819,6 +47208,23 @@ entities: rot: 3.141592653589793 rad pos: -47.5,24.5 parent: 2 + - uid: 15246 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -71.5,36.5 + parent: 2 + - uid: 15249 + components: + - type: Transform + pos: -73.5,30.5 + parent: 2 + - uid: 15286 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -61.5,22.5 + parent: 2 - proto: EmergencyMedipen entities: - uid: 6925 @@ -44836,28 +47242,26 @@ entities: - type: Transform pos: -35.501785,-19.213305 parent: 2 -- proto: EmergencyOxygenTank - entities: - - uid: 13056 - components: - - type: Transform - parent: 5830 - - type: GasTank - toggleActionEntity: 13060 - - type: Physics - canCollide: False - - type: ActionsContainer - - type: ContainerContainer - containers: - actions: !type:Container - ents: - - 13060 - proto: EmergencyOxygenTankFilled entities: - - uid: 14295 + - uid: 15921 components: - type: Transform - pos: 0.38033247,36.504353 + pos: 3.5302439,46.49772 + parent: 2 +- proto: Emitter + entities: + - uid: 14875 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -70.5,33.5 + parent: 2 + - uid: 14876 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -74.5,33.5 parent: 2 - proto: EncryptionKeyBinary entities: @@ -45146,11 +47550,6 @@ entities: parent: 2 - type: FaxMachine name: Мостик - - uid: 5850 - components: - - type: Transform - pos: 2.5,31.5 - parent: 2 - uid: 6521 components: - type: Transform @@ -45490,8 +47889,8 @@ entities: - uid: 4851 components: - type: Transform - rot: 1.5707963267948966 rad - pos: -57.5,32.5 + rot: 3.141592653589793 rad + pos: -47.5,23.5 parent: 2 - uid: 12721 components: @@ -45499,11 +47898,6 @@ entities: rot: 3.141592653589793 rad pos: -17.5,16.5 parent: 2 - - uid: 14646 - components: - - type: Transform - pos: -47.5,23.5 - parent: 2 - proto: FireExtinguisher entities: - uid: 7180 @@ -45861,11 +48255,21 @@ entities: - type: Transform pos: -16.5,-39.5 parent: 2 + - uid: 361 + components: + - type: Transform + pos: 5.5,24.5 + parent: 2 - uid: 377 components: - type: Transform pos: -22.5,-42.5 parent: 2 + - uid: 412 + components: + - type: Transform + pos: 6.5,31.5 + parent: 2 - uid: 444 components: - type: Transform @@ -46209,18 +48613,6 @@ entities: - invalid deviceLists: - 12967 - - uid: 6331 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 1.5,11.5 - parent: 2 - - uid: 6332 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 1.5,13.5 - parent: 2 - uid: 6333 components: - type: Transform @@ -46831,6 +49223,11 @@ entities: - invalid deviceLists: - 12967 + - uid: 8733 + components: + - type: Transform + pos: 10.5,40.5 + parent: 2 - uid: 9050 components: - type: Transform @@ -46878,6 +49275,11 @@ entities: rot: 1.5707963267948966 rad pos: -13.5,-13.5 parent: 2 + - uid: 12703 + components: + - type: Transform + pos: 1.5,40.5 + parent: 2 - uid: 12947 components: - type: Transform @@ -47053,6 +49455,74 @@ entities: rot: -1.5707963267948966 rad pos: -48.5,23.5 parent: 2 + - uid: 14823 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -51.5,17.5 + parent: 2 + - uid: 14956 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -38.5,17.5 + parent: 2 + - uid: 14957 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -42.5,17.5 + parent: 2 + - uid: 15605 + components: + - type: Transform + pos: -54.5,20.5 + parent: 2 + - uid: 15606 + components: + - type: Transform + pos: -54.5,22.5 + parent: 2 + - uid: 15607 + components: + - type: Transform + pos: -62.5,25.5 + parent: 2 + - uid: 15608 + components: + - type: Transform + pos: -69.5,25.5 + parent: 2 + - uid: 15609 + components: + - type: Transform + pos: -72.5,27.5 + parent: 2 + - uid: 15616 + components: + - type: Transform + pos: -75.5,36.5 + parent: 2 + - uid: 15617 + components: + - type: Transform + pos: -69.5,36.5 + parent: 2 + - uid: 15948 + components: + - type: Transform + pos: 9.5,31.5 + parent: 2 + - uid: 15953 + components: + - type: Transform + pos: 10.5,33.5 + parent: 2 + - uid: 15955 + components: + - type: Transform + pos: 6.5,24.5 + parent: 2 - proto: Fireplace entities: - uid: 4841 @@ -47128,14 +49598,6 @@ entities: parent: 2 - type: Fixtures fixtures: {} - - uid: 5841 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 4.5,34.5 - parent: 2 - - type: Fixtures - fixtures: {} - uid: 8262 components: - type: Transform @@ -47318,6 +49780,12 @@ entities: rot: 1.5707963267948966 rad pos: -7.775181,24.57921 parent: 2 + - uid: 15620 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -1.5306702,31.646652 + parent: 2 - proto: FloraRockSolid02 entities: - uid: 12311 @@ -47438,6 +49906,11 @@ entities: - type: Transform pos: -29.644344,11.708272 parent: 2 + - uid: 16007 + components: + - type: Transform + pos: -13.552152,-12.40099 + parent: 2 - proto: FoodBoxDonut entities: - uid: 5642 @@ -47450,12 +49923,10 @@ entities: - type: Transform pos: 6.594899,10.74697 parent: 2 -- proto: FoodBreadMeatXenoSlice - entities: - - uid: 11892 + - uid: 15964 components: - type: Transform - pos: -56.689316,21.17732 + pos: 7.525154,35.660217 parent: 2 - proto: FoodBurgerRobot entities: @@ -47464,6 +49935,29 @@ entities: - type: Transform pos: -26.535,-41.22935 parent: 2 +- proto: FoodCakeSuppermatterSlice + entities: + - uid: 15541 + components: + - type: Transform + pos: -72.32722,24.66505 + parent: 2 +- proto: FoodCheese + entities: + - uid: 15642 + components: + - type: Transform + parent: 15640 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15643 + components: + - type: Transform + parent: 15640 + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: FoodCondimentBottleVinegar entities: - uid: 13612 @@ -47476,13 +49970,20 @@ entities: - uid: 2918 components: - type: Transform - pos: -17.275978,-15.020586 + pos: -16.506313,-13.114813 parent: 2 - uid: 11679 components: - type: Transform - pos: -17.306704,-15.239864 + pos: -16.52631,-12.894079 parent: 2 + - uid: 15648 + components: + - type: Transform + parent: 15640 + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: FoodEggplant entities: - uid: 13098 @@ -47490,6 +49991,29 @@ entities: - type: Transform pos: -35.39263,-52.424767 parent: 2 +- proto: FoodMeat + entities: + - uid: 15644 + components: + - type: Transform + parent: 15640 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15646 + components: + - type: Transform + parent: 15640 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15650 + components: + - type: Transform + parent: 15640 + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: FoodMeatHuman entities: - uid: 14381 @@ -47506,18 +50030,6 @@ entities: - type: Transform pos: -36.552483,34.528954 parent: 2 -- proto: FoodMeatXeno - entities: - - uid: 5519 - components: - - type: Transform - pos: -57.16129,20.616848 - parent: 2 - - uid: 11893 - components: - - type: Transform - pos: -56.099346,20.307114 - parent: 2 - proto: FoodPieBananaCream entities: - uid: 600 @@ -47552,13 +50064,6 @@ entities: - type: Transform pos: -7.45556,-23.30443 parent: 2 -- proto: FoodPlatePlastic - entities: - - uid: 5855 - components: - - type: Transform - pos: 7.574697,32.524384 - parent: 2 - proto: FoodPlateSmall entities: - uid: 8962 @@ -47581,63 +50086,71 @@ entities: - type: Transform pos: -7.4745345,-24.26073 parent: 2 -- proto: FoodTinMRE +- proto: FoodSnackNutribrick entities: - - uid: 1114 + - uid: 2106 components: - type: Transform - parent: 596 + parent: 15630 - type: Physics canCollide: False - - uid: 1115 + - type: InsideEntityStorage + - uid: 2194 components: - type: Transform - parent: 596 + parent: 15630 - type: Physics canCollide: False - - uid: 1116 + - type: InsideEntityStorage + - uid: 2452 components: - type: Transform - parent: 596 + parent: 15630 - type: Physics canCollide: False - - uid: 1117 + - type: InsideEntityStorage + - uid: 2496 components: - type: Transform - parent: 596 + parent: 15630 - type: Physics canCollide: False - - uid: 12703 + - type: InsideEntityStorage + - uid: 3853 components: - type: Transform - parent: 12702 + parent: 15630 - type: Physics canCollide: False - - uid: 12704 + - type: InsideEntityStorage + - uid: 5677 components: - type: Transform - parent: 12702 + parent: 15630 - type: Physics canCollide: False - - uid: 12705 + - type: InsideEntityStorage + - uid: 5691 components: - type: Transform - parent: 12702 + parent: 15630 - type: Physics canCollide: False - - uid: 12706 + - type: InsideEntityStorage + - uid: 5705 components: - type: Transform - parent: 12702 + parent: 15630 - type: Physics canCollide: False -- proto: ForkPlastic - entities: - - uid: 5853 + - type: InsideEntityStorage + - uid: 5709 components: - type: Transform - pos: 7.246572,32.524384 - parent: 2 + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: GasAnalyzer entities: - uid: 6961 @@ -47682,6 +50195,30 @@ entities: rot: 3.141592653589793 rad pos: -46.5,27.5 parent: 2 + - uid: 14961 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -70.5,36.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14962 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -72.5,36.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14963 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -74.5,36.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' - proto: GasFilterFlipped entities: - uid: 6957 @@ -47732,6 +50269,10 @@ entities: rot: -1.5707963267948966 rad pos: -48.5,25.5 parent: 2 + - type: GasMixer + inletTwoConcentration: 0.22000003 + inletOneConcentration: 0.78 + targetPressure: 300 - type: AtmosPipeColor color: '#0055CCFF' - proto: GasMixerFlipped @@ -47821,6 +50362,20 @@ entities: - type: Transform pos: -47.5,37.5 parent: 2 + - uid: 14878 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -72.5,34.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15342 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -76.5,39.5 + parent: 2 - proto: GasPipeBend entities: - uid: 1714 @@ -48288,6 +50843,29 @@ entities: - type: Transform pos: -39.5,31.5 parent: 2 + - uid: 13260 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -72.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 13261 + components: + - type: Transform + pos: -60.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 13262 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -60.5,21.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' - uid: 13354 components: - type: Transform @@ -48338,6 +50916,182 @@ entities: - type: Transform pos: -46.5,34.5 parent: 2 + - uid: 14883 + components: + - type: Transform + pos: -68.5,36.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14884 + components: + - type: Transform + pos: -70.5,37.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14885 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -68.5,32.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14889 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -75.5,33.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14890 + components: + - type: Transform + pos: -67.5,31.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14894 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -67.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14901 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -77.5,34.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14910 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -77.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14965 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -75.5,37.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14968 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -77.5,36.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14998 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -50.5,21.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14999 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -50.5,27.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15239 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -77.5,39.5 + parent: 2 + - uid: 15584 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -59.5,22.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15585 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -61.5,20.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15586 + components: + - type: Transform + pos: -61.5,24.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15587 + components: + - type: Transform + pos: -59.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15588 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -70.5,24.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15589 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -71.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15772 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 9.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15773 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 2.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15774 + components: + - type: Transform + pos: 9.5,37.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15775 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 2.5,37.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' - proto: GasPipeFourway entities: - uid: 2868 @@ -48497,6 +51251,30 @@ entities: parent: 2 - type: AtmosPipeColor color: '#0055CCFF' + - uid: 555 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -61.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 586 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -67.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 588 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -69.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' - uid: 611 components: - type: Transform @@ -48779,6 +51557,14 @@ entities: parent: 2 - type: AtmosPipeColor color: '#0055CCFF' + - uid: 1879 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -72.5,28.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' - uid: 1973 components: - type: Transform @@ -48787,6 +51573,13 @@ entities: parent: 2 - type: AtmosPipeColor color: '#0055CCFF' + - uid: 2065 + components: + - type: Transform + pos: -60.5,23.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' - uid: 2120 components: - type: Transform @@ -56542,6 +59335,8 @@ entities: rot: 1.5707963267948966 rad pos: -3.5,-35.5 parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' - uid: 4855 components: - type: Transform @@ -56677,14 +59472,6 @@ entities: parent: 2 - type: AtmosPipeColor color: '#0055CCFF' - - uid: 5690 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 6.5,29.5 - parent: 2 - - type: AtmosPipeColor - color: '#E32636FF' - uid: 5767 components: - type: Transform @@ -56760,6 +59547,11 @@ entities: - type: Transform pos: -52.5,37.5 parent: 2 + - uid: 6040 + components: + - type: Transform + pos: -77.5,38.5 + parent: 2 - uid: 6055 components: - type: Transform @@ -57692,6 +60484,13 @@ entities: parent: 2 - type: AtmosPipeColor color: '#0055CCFF' + - uid: 11935 + components: + - type: Transform + pos: -60.5,24.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' - uid: 11969 components: - type: Transform @@ -57714,6 +60513,53 @@ entities: parent: 2 - type: AtmosPipeColor color: '#0055CCFF' + - uid: 12414 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -72.5,27.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 12450 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -70.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 12458 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -68.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 12552 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -62.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 12555 + components: + - type: Transform + pos: -60.5,22.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 12557 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -59.5,21.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' - uid: 12635 components: - type: Transform @@ -57770,6 +60616,14 @@ entities: parent: 2 - type: AtmosPipeColor color: '#0055CCFF' + - uid: 12919 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -58.5,21.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' - uid: 12931 components: - type: Transform @@ -57818,14 +60672,14 @@ entities: parent: 2 - type: AtmosPipeColor color: '#0055CCFF' - - uid: 13040 + - uid: 13067 components: - type: Transform - rot: 3.141592653589793 rad - pos: 5.5,29.5 + rot: 1.5707963267948966 rad + pos: -57.5,21.5 parent: 2 - type: AtmosPipeColor - color: '#0055CCFF' + color: '#78DBE2FF' - uid: 13083 components: - type: Transform @@ -57906,6 +60760,22 @@ entities: parent: 2 - type: AtmosPipeColor color: '#0055CCFF' + - uid: 13129 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -56.5,21.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 13259 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -55.5,21.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' - uid: 13368 components: - type: Transform @@ -58027,6 +60897,893 @@ entities: parent: 2 - type: AtmosPipeColor color: '#0055CCFF' + - uid: 14860 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -76.5,36.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14879 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -71.5,32.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14880 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -70.5,32.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14886 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -75.5,34.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14887 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -76.5,33.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14891 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -68.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14893 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -70.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14897 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -69.5,32.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14899 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -77.5,37.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14902 + components: + - type: Transform + pos: -77.5,32.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14906 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -74.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14907 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -73.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14908 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -71.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14911 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -73.5,34.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14912 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -74.5,34.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14913 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -75.5,34.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14921 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -69.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14948 + components: + - type: Transform + pos: -68.5,35.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14964 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -76.5,33.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14966 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -73.5,37.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14967 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -71.5,37.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14969 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -69.5,36.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14970 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -71.5,36.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14971 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -73.5,36.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14972 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -75.5,36.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14973 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -75.5,35.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14975 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -75.5,36.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14978 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -75.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15000 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -49.5,27.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15001 + components: + - type: Transform + pos: -50.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15002 + components: + - type: Transform + pos: -50.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15003 + components: + - type: Transform + pos: -50.5,24.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15004 + components: + - type: Transform + pos: -50.5,23.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15005 + components: + - type: Transform + pos: -50.5,22.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15006 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -51.5,21.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15007 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -52.5,21.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15008 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -53.5,21.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15009 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -54.5,21.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15010 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -65.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15011 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -66.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15012 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -71.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15053 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -64.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15072 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -63.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15135 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -68.5,34.5 + parent: 2 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 15166 + components: + - type: Transform + pos: -72.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15543 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -55.5,22.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15546 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -54.5,22.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15547 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -53.5,22.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15549 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -56.5,22.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15550 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -57.5,22.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15552 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -53.5,20.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15553 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -54.5,20.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15554 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -55.5,20.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15555 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -56.5,20.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15556 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -57.5,20.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15557 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -58.5,20.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15559 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -60.5,20.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15560 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -61.5,21.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15561 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -61.5,22.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15562 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -61.5,23.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15563 + components: + - type: Transform + pos: -59.5,23.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15564 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -62.5,24.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15565 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -63.5,24.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15566 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -64.5,24.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15568 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -66.5,24.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15569 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -67.5,24.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15570 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -68.5,24.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15571 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -69.5,24.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15572 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -62.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15573 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -63.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15575 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -65.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15576 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -66.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15577 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -67.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15578 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -68.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15579 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -69.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15580 + components: + - type: Transform + pos: -59.5,24.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15581 + components: + - type: Transform + pos: -59.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15582 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -60.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15583 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -61.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15590 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -70.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15591 + components: + - type: Transform + pos: -70.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15592 + components: + - type: Transform + pos: -70.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15593 + components: + - type: Transform + pos: -70.5,27.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15594 + components: + - type: Transform + pos: -70.5,28.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15595 + components: + - type: Transform + pos: -71.5,27.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15596 + components: + - type: Transform + pos: -71.5,28.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15743 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 6.5,29.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15751 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 5.5,29.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15754 + components: + - type: Transform + pos: 6.5,31.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15755 + components: + - type: Transform + pos: 6.5,31.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15756 + components: + - type: Transform + pos: 6.5,32.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15757 + components: + - type: Transform + pos: 5.5,31.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15758 + components: + - type: Transform + pos: 5.5,32.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15759 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 7.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15761 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 8.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15762 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 9.5,34.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15763 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 9.5,31.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15764 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 9.5,32.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15765 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 9.5,33.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15766 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 2.5,31.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15767 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 2.5,32.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15768 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 2.5,33.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15769 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 2.5,34.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15770 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 4.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15771 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 3.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15776 + components: + - type: Transform + pos: 9.5,35.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15777 + components: + - type: Transform + pos: 9.5,35.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15778 + components: + - type: Transform + pos: 9.5,36.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15779 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 8.5,37.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15780 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 7.5,37.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15781 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 3.5,37.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15782 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 4.5,37.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15783 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 2.5,36.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15784 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 2.5,35.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' - proto: GasPipeTJunction entities: - uid: 77 @@ -58960,6 +62717,104 @@ entities: parent: 2 - type: AtmosPipeColor color: '#0055CCFF' + - uid: 14881 + components: + - type: Transform + pos: -72.5,37.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14898 + components: + - type: Transform + pos: -74.5,37.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14900 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -77.5,31.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14903 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -77.5,33.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14909 + components: + - type: Transform + pos: -72.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14979 + components: + - type: Transform + pos: -76.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15035 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -76.5,28.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15551 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -59.5,20.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15567 + components: + - type: Transform + pos: -64.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15574 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -65.5,24.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15597 + components: + - type: Transform + pos: -58.5,22.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15746 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 5.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15753 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 6.5,30.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' - proto: GasPort entities: - uid: 6426 @@ -59035,6 +62890,22 @@ entities: parent: 2 - type: AtmosPipeColor color: '#E32636FF' + - uid: 15129 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -77.5,28.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15133 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -75.5,28.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' - proto: GasPressurePump entities: - uid: 932 @@ -59128,14 +62999,54 @@ entities: parent: 2 - type: AtmosPipeColor color: '#0055CCFF' + - uid: 12398 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -72.5,29.5 + parent: 2 + - type: GasPressurePump + targetPressure: 50 + - type: AtmosPipeColor + color: '#78DBE2FF' - uid: 14643 components: - type: Transform rot: -1.5707963267948966 rad pos: -48.5,27.5 parent: 2 + - type: GasPressurePump + targetPressure: 4500 - type: AtmosPipeColor - color: '#0055CCFF' + color: '#78DBE2FF' + - uid: 14882 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -68.5,33.5 + parent: 2 + - type: GasPressurePump + targetPressure: 4500 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 14974 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -76.5,34.5 + parent: 2 + - type: GasPressurePump + targetPressure: 200 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 15091 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -76.5,29.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' - proto: GasThermoMachineFreezer entities: - uid: 6955 @@ -59143,29 +63054,47 @@ entities: - type: Transform pos: -38.5,-3.5 parent: 2 - - uid: 14704 + - uid: 14820 components: - type: Transform - rot: 3.141592653589793 rad - pos: -51.5,20.5 + rot: 1.5707963267948966 rad + pos: -56.5,31.5 parent: 2 - - uid: 14705 + - uid: 14821 components: - type: Transform - rot: 3.141592653589793 rad - pos: -52.5,20.5 + rot: 1.5707963267948966 rad + pos: -56.5,30.5 parent: 2 + - uid: 14895 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -68.5,31.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' + - uid: 14896 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -76.5,31.5 + parent: 2 + - type: AtmosPipeColor + color: '#78DBE2FF' - proto: GasThermoMachineHeater entities: - - uid: 14702 + - uid: 1777 components: - type: Transform - pos: -52.5,22.5 + rot: 1.5707963267948966 rad + pos: -56.5,29.5 parent: 2 - - uid: 14703 + - uid: 3410 components: - type: Transform - pos: -51.5,22.5 + rot: 1.5707963267948966 rad + pos: -56.5,28.5 parent: 2 - proto: GasVentPump entities: @@ -60125,13 +64054,6 @@ entities: - 12937 - type: AtmosPipeColor color: '#0055CCFF' - - uid: 13063 - components: - - type: Transform - pos: 5.5,30.5 - parent: 2 - - type: AtmosPipeColor - color: '#0055CCFF' - uid: 13095 components: - type: Transform @@ -60167,6 +64089,87 @@ entities: - 14668 - type: AtmosPipeColor color: '#0055CCFF' + - uid: 15599 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -58.5,21.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15600 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -64.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15601 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -71.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15604 + components: + - type: Transform + pos: -71.5,29.5 + parent: 2 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15789 + components: + - type: Transform + pos: 5.5,23.5 + parent: 2 + - type: DeviceNetwork + configurators: + - invalid + deviceLists: + - 6331 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15790 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 4.5,30.5 + parent: 2 + - type: DeviceNetwork + configurators: + - invalid + deviceLists: + - 6331 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15791 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 5.5,37.5 + parent: 2 + - type: DeviceNetwork + configurators: + - invalid + deviceLists: + - 6331 + - type: AtmosPipeColor + color: '#0055CCFF' + - uid: 15792 + components: + - type: Transform + pos: 5.5,33.5 + parent: 2 + - type: DeviceNetwork + configurators: + - invalid + deviceLists: + - 6331 + - type: AtmosPipeColor + color: '#0055CCFF' - proto: GasVentScrubber entities: - uid: 2424 @@ -61104,13 +65107,6 @@ entities: - 14667 - type: AtmosPipeColor color: '#E32636FF' - - uid: 12556 - components: - - type: Transform - pos: 6.5,30.5 - parent: 2 - - type: AtmosPipeColor - color: '#E32636FF' - uid: 12748 components: - type: Transform @@ -61165,6 +65161,95 @@ entities: - type: DeviceNetwork deviceLists: - 14668 + - uid: 14877 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -72.5,32.5 + parent: 2 + - type: DeviceNetwork + deviceLists: + - 15025 + - type: AtmosPipeColor + color: '#F19CBBFF' + - uid: 15558 + components: + - type: Transform + pos: -65.5,25.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15598 + components: + - type: Transform + pos: -59.5,21.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15602 + components: + - type: Transform + pos: -70.5,26.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15603 + components: + - type: Transform + pos: -70.5,29.5 + parent: 2 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15709 + components: + - type: Transform + pos: 6.5,33.5 + parent: 2 + - type: DeviceNetwork + configurators: + - invalid + deviceLists: + - 6331 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15785 + components: + - type: Transform + pos: 6.5,23.5 + parent: 2 + - type: DeviceNetwork + configurators: + - invalid + deviceLists: + - 6331 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15786 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 7.5,30.5 + parent: 2 + - type: DeviceNetwork + configurators: + - invalid + deviceLists: + - 6331 + - type: AtmosPipeColor + color: '#E32636FF' + - uid: 15788 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 6.5,37.5 + parent: 2 + - type: DeviceNetwork + configurators: + - invalid + deviceLists: + - 6331 + - type: AtmosPipeColor + color: '#E32636FF' - proto: GasVolumePump entities: - uid: 14551 @@ -61218,6 +65303,80 @@ entities: - type: Transform pos: -35.5,15.5 parent: 2 +- proto: GrenadeFlashBang + entities: + - uid: 5740 + components: + - type: Transform + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 5787 + components: + - type: Transform + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 5788 + components: + - type: Transform + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 5789 + components: + - type: Transform + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 5790 + components: + - type: Transform + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 5791 + components: + - type: Transform + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage +- proto: GrenadeStinger + entities: + - uid: 15721 + components: + - type: Transform + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15722 + components: + - type: Transform + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15725 + components: + - type: Transform + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15726 + components: + - type: Transform + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: GreyHampter entities: - uid: 14470 @@ -61335,11 +65494,6 @@ entities: rot: 1.5707963267948966 rad pos: 9.5,1.5 parent: 2 - - uid: 409 - components: - - type: Transform - pos: -1.5,10.5 - parent: 2 - uid: 415 components: - type: Transform @@ -61365,6 +65519,12 @@ entities: - type: Transform pos: -21.5,-50.5 parent: 2 + - uid: 564 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 8.5,32.5 + parent: 2 - uid: 763 components: - type: Transform @@ -61387,6 +65547,24 @@ entities: rot: 3.141592653589793 rad pos: -9.5,32.5 parent: 2 + - uid: 958 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 7.5,31.5 + parent: 2 + - uid: 960 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 4.5,31.5 + parent: 2 + - uid: 1012 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 3.5,32.5 + parent: 2 - uid: 1043 components: - type: Transform @@ -61751,11 +65929,6 @@ entities: rot: 3.141592653589793 rad pos: -53.5,-19.5 parent: 2 - - uid: 1903 - components: - - type: Transform - pos: -1.5,11.5 - parent: 2 - uid: 1915 components: - type: Transform @@ -61838,11 +66011,6 @@ entities: - type: Transform pos: 4.5,3.5 parent: 2 - - uid: 2106 - components: - - type: Transform - pos: -1.5,9.5 - parent: 2 - uid: 2117 components: - type: Transform @@ -61920,12 +66088,22 @@ entities: rot: 1.5707963267948966 rad pos: -70.5,1.5 parent: 2 + - uid: 4448 + components: + - type: Transform + pos: 4.5,36.5 + parent: 2 - uid: 4521 components: - type: Transform rot: -1.5707963267948966 rad pos: 5.5,1.5 parent: 2 + - uid: 4789 + components: + - type: Transform + pos: 3.5,35.5 + parent: 2 - uid: 4815 components: - type: Transform @@ -62113,53 +66291,12 @@ entities: - type: Transform pos: -6.5,6.5 parent: 2 - - uid: 5617 - components: - - type: Transform - pos: 9.5,33.5 - parent: 2 - uid: 5678 components: - type: Transform rot: 1.5707963267948966 rad pos: 2.5,6.5 parent: 2 - - uid: 5733 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 1.5,10.5 - parent: 2 - - uid: 5734 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 1.5,9.5 - parent: 2 - - uid: 5737 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 1.5,14.5 - parent: 2 - - uid: 5738 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 1.5,15.5 - parent: 2 - - uid: 5739 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 2.5,16.5 - parent: 2 - - uid: 5740 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 3.5,16.5 - parent: 2 - uid: 5743 components: - type: Transform @@ -62182,6 +66319,31 @@ entities: - type: Transform pos: 6.5,11.5 parent: 2 + - uid: 5832 + components: + - type: Transform + pos: 6.5,36.5 + parent: 2 + - uid: 5843 + components: + - type: Transform + pos: 8.5,35.5 + parent: 2 + - uid: 5852 + components: + - type: Transform + pos: 3.5,34.5 + parent: 2 + - uid: 5853 + components: + - type: Transform + pos: 8.5,34.5 + parent: 2 + - uid: 5854 + components: + - type: Transform + pos: 5.5,36.5 + parent: 2 - uid: 5857 components: - type: Transform @@ -62197,46 +66359,6 @@ entities: - type: Transform pos: 10.5,28.5 parent: 2 - - uid: 5860 - components: - - type: Transform - pos: 11.5,29.5 - parent: 2 - - uid: 5861 - components: - - type: Transform - pos: 11.5,30.5 - parent: 2 - - uid: 5862 - components: - - type: Transform - pos: 11.5,31.5 - parent: 2 - - uid: 5863 - components: - - type: Transform - pos: 8.5,33.5 - parent: 2 - - uid: 5864 - components: - - type: Transform - pos: 7.5,33.5 - parent: 2 - - uid: 5865 - components: - - type: Transform - pos: 0.5,31.5 - parent: 2 - - uid: 5866 - components: - - type: Transform - pos: 0.5,30.5 - parent: 2 - - uid: 5867 - components: - - type: Transform - pos: 0.5,29.5 - parent: 2 - uid: 5868 components: - type: Transform @@ -62258,6 +66380,18 @@ entities: rot: -1.5707963267948966 rad pos: 3.5,1.5 parent: 2 + - uid: 5911 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 8.5,42.5 + parent: 2 + - uid: 5912 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 9.5,40.5 + parent: 2 - uid: 5923 components: - type: Transform @@ -62288,6 +66422,12 @@ entities: - type: Transform pos: 4.5,25.5 parent: 2 + - uid: 5936 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 2.5,33.5 + parent: 2 - uid: 6145 components: - type: Transform @@ -62448,6 +66588,12 @@ entities: rot: 1.5707963267948966 rad pos: -4.5,-75.5 parent: 2 + - uid: 6664 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 0.5,40.5 + parent: 2 - uid: 6718 components: - type: Transform @@ -64073,6 +68219,42 @@ entities: rot: 1.5707963267948966 rad pos: -81.5,-29.5 parent: 2 + - uid: 11596 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 9.5,33.5 + parent: 2 + - uid: 11608 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 3.5,42.5 + parent: 2 + - uid: 11609 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 2.5,40.5 + parent: 2 + - uid: 11616 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 8.5,41.5 + parent: 2 + - uid: 11625 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 3.5,41.5 + parent: 2 + - uid: 11627 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 11.5,40.5 + parent: 2 - uid: 11669 components: - type: Transform @@ -64227,6 +68409,17 @@ entities: rot: 3.141592653589793 rad pos: -66.5,-35.5 parent: 2 + - uid: 13060 + components: + - type: Transform + pos: 7.5,36.5 + parent: 2 + - uid: 13063 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 5.5,31.5 + parent: 2 - uid: 13546 components: - type: Transform @@ -64439,6 +68632,11 @@ entities: - type: Transform pos: 11.5,-17.5 parent: 2 + - uid: 14197 + components: + - type: Transform + pos: 2.5,13.5 + parent: 2 - uid: 14311 components: - type: Transform @@ -64642,6 +68840,134 @@ entities: - type: Transform pos: -20.5,-76.5 parent: 2 + - uid: 14869 + components: + - type: Transform + pos: -73.5,32.5 + parent: 2 + - uid: 14870 + components: + - type: Transform + pos: -73.5,33.5 + parent: 2 + - uid: 14871 + components: + - type: Transform + pos: -73.5,34.5 + parent: 2 + - uid: 14872 + components: + - type: Transform + pos: -71.5,34.5 + parent: 2 + - uid: 14873 + components: + - type: Transform + pos: -71.5,33.5 + parent: 2 + - uid: 14874 + components: + - type: Transform + pos: -71.5,32.5 + parent: 2 + - uid: 15146 + components: + - type: Transform + pos: -71.5,27.5 + parent: 2 + - uid: 15147 + components: + - type: Transform + pos: -73.5,27.5 + parent: 2 + - uid: 15343 + components: + - type: Transform + pos: -74.5,39.5 + parent: 2 + - uid: 15369 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -73.5,39.5 + parent: 2 + - uid: 15370 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -72.5,39.5 + parent: 2 + - uid: 15371 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -71.5,39.5 + parent: 2 + - uid: 15372 + components: + - type: Transform + pos: -70.5,39.5 + parent: 2 + - uid: 15373 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -65.5,35.5 + parent: 2 + - uid: 15374 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -65.5,34.5 + parent: 2 + - uid: 15375 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -65.5,33.5 + parent: 2 + - uid: 15376 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -65.5,32.5 + parent: 2 + - uid: 15377 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -65.5,31.5 + parent: 2 + - uid: 15378 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -79.5,31.5 + parent: 2 + - uid: 15379 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -79.5,32.5 + parent: 2 + - uid: 15380 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -79.5,33.5 + parent: 2 + - uid: 15381 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -79.5,34.5 + parent: 2 + - uid: 15382 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -79.5,35.5 + parent: 2 - proto: GrilleBroken entities: - uid: 909 @@ -64684,17 +69010,6 @@ entities: rot: 3.141592653589793 rad pos: -66.5,-8.5 parent: 2 - - uid: 5629 - components: - - type: Transform - pos: 13.5,21.5 - parent: 2 - - uid: 5630 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 13.5,14.5 - parent: 2 - uid: 5768 components: - type: Transform @@ -64725,11 +69040,6 @@ entities: rot: 1.5707963267948966 rad pos: 11.5,8.5 parent: 2 - - uid: 6669 - components: - - type: Transform - pos: 13.5,14.5 - parent: 2 - uid: 6726 components: - type: Transform @@ -64865,12 +69175,6 @@ entities: rot: -1.5707963267948966 rad pos: 15.5,10.5 parent: 2 - - uid: 13067 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 13.5,21.5 - parent: 2 - uid: 14285 components: - type: Transform @@ -65414,6 +69718,19 @@ entities: - type: Transform pos: -21.5,11.5 parent: 2 +- proto: GrilleDiagonal + entities: + - uid: 5835 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 8.5,36.5 + parent: 2 + - uid: 5856 + components: + - type: Transform + pos: 3.5,36.5 + parent: 2 - proto: GroundCannabis entities: - uid: 6540 @@ -65498,31 +69815,6 @@ entities: - type: Transform pos: -60.5,29.5 parent: 2 - - uid: 935 - components: - - type: Transform - pos: -59.5,24.5 - parent: 2 - - uid: 937 - components: - - type: Transform - pos: -60.5,22.5 - parent: 2 - - uid: 940 - components: - - type: Transform - pos: -60.5,25.5 - parent: 2 - - uid: 941 - components: - - type: Transform - pos: -60.5,26.5 - parent: 2 - - uid: 946 - components: - - type: Transform - pos: -60.5,27.5 - parent: 2 - uid: 1139 components: - type: Transform @@ -65533,11 +69825,6 @@ entities: - type: Transform pos: -61.5,30.5 parent: 2 - - uid: 1272 - components: - - type: Transform - pos: -60.5,21.5 - parent: 2 - uid: 1432 components: - type: Transform @@ -65588,26 +69875,6 @@ entities: - type: Transform pos: -47.5,44.5 parent: 2 - - uid: 1768 - components: - - type: Transform - pos: -57.5,17.5 - parent: 2 - - uid: 1772 - components: - - type: Transform - pos: -57.5,18.5 - parent: 2 - - uid: 1773 - components: - - type: Transform - pos: -57.5,19.5 - parent: 2 - - uid: 1777 - components: - - type: Transform - pos: -57.5,16.5 - parent: 2 - uid: 1855 components: - type: Transform @@ -65633,11 +69900,6 @@ entities: - type: Transform pos: -56.5,15.5 parent: 2 - - uid: 3410 - components: - - type: Transform - pos: -56.5,16.5 - parent: 2 - uid: 3906 components: - type: Transform @@ -65678,21 +69940,11 @@ entities: - type: Transform pos: -58.5,41.5 parent: 2 - - uid: 5940 - components: - - type: Transform - pos: -59.5,27.5 - parent: 2 - uid: 5953 components: - type: Transform pos: -44.5,44.5 parent: 2 - - uid: 5960 - components: - - type: Transform - pos: -59.5,26.5 - parent: 2 - uid: 6022 components: - type: Transform @@ -65703,21 +69955,11 @@ entities: - type: Transform pos: -58.5,42.5 parent: 2 - - uid: 6036 - components: - - type: Transform - pos: -59.5,34.5 - parent: 2 - uid: 6037 components: - type: Transform pos: -59.5,29.5 parent: 2 - - uid: 6040 - components: - - type: Transform - pos: -59.5,32.5 - parent: 2 - uid: 6051 components: - type: Transform @@ -65738,26 +69980,11 @@ entities: - type: Transform pos: -39.5,39.5 parent: 2 - - uid: 6074 - components: - - type: Transform - pos: -58.5,22.5 - parent: 2 - uid: 6098 components: - type: Transform pos: -60.5,30.5 parent: 2 - - uid: 6099 - components: - - type: Transform - pos: -60.5,32.5 - parent: 2 - - uid: 6100 - components: - - type: Transform - pos: -60.5,31.5 - parent: 2 - uid: 6101 components: - type: Transform @@ -65778,21 +70005,11 @@ entities: - type: Transform pos: -58.5,33.5 parent: 2 - - uid: 6106 - components: - - type: Transform - pos: -59.5,23.5 - parent: 2 - uid: 6107 components: - type: Transform pos: -59.5,37.5 parent: 2 - - uid: 6119 - components: - - type: Transform - pos: -59.5,22.5 - parent: 2 - uid: 6129 components: - type: Transform @@ -65828,11 +70045,6 @@ entities: - type: Transform pos: -26.5,22.5 parent: 2 - - uid: 6190 - components: - - type: Transform - pos: -41.5,35.5 - parent: 2 - uid: 6191 components: - type: Transform @@ -65933,26 +70145,11 @@ entities: - type: Transform pos: -56.5,6.5 parent: 2 - - uid: 6766 - components: - - type: Transform - pos: -60.5,23.5 - parent: 2 - uid: 6797 components: - type: Transform pos: -31.5,22.5 parent: 2 - - uid: 6858 - components: - - type: Transform - pos: -61.5,29.5 - parent: 2 - - uid: 6923 - components: - - type: Transform - pos: -58.5,19.5 - parent: 2 - uid: 8820 components: - type: Transform @@ -65988,336 +70185,11 @@ entities: - type: Transform pos: 4.5,-42.5 parent: 2 - - uid: 11517 - components: - - type: Transform - pos: -0.5,33.5 - parent: 2 - - uid: 11520 - components: - - type: Transform - pos: 0.5,38.5 - parent: 2 - - uid: 11528 - components: - - type: Transform - pos: 11.5,35.5 - parent: 2 - - uid: 11540 - components: - - type: Transform - pos: -0.5,35.5 - parent: 2 - - uid: 11557 - components: - - type: Transform - pos: -0.5,36.5 - parent: 2 - - uid: 11560 - components: - - type: Transform - pos: -0.5,34.5 - parent: 2 - - uid: 11561 - components: - - type: Transform - pos: -1.5,33.5 - parent: 2 - - uid: 11562 - components: - - type: Transform - pos: 1.5,41.5 - parent: 2 - - uid: 11563 - components: - - type: Transform - pos: -0.5,32.5 - parent: 2 - - uid: 11564 - components: - - type: Transform - pos: 0.5,35.5 - parent: 2 - - uid: 11565 - components: - - type: Transform - pos: -0.5,37.5 - parent: 2 - - uid: 11567 - components: - - type: Transform - pos: 0.5,39.5 - parent: 2 - - uid: 11569 - components: - - type: Transform - pos: 0.5,37.5 - parent: 2 - - uid: 11570 - components: - - type: Transform - pos: 1.5,43.5 - parent: 2 - - uid: 11571 - components: - - type: Transform - pos: 1.5,38.5 - parent: 2 - - uid: 11572 - components: - - type: Transform - pos: 1.5,40.5 - parent: 2 - - uid: 11573 - components: - - type: Transform - pos: 1.5,44.5 - parent: 2 - - uid: 11574 - components: - - type: Transform - pos: 2.5,46.5 - parent: 2 - - uid: 11575 - components: - - type: Transform - pos: 2.5,45.5 - parent: 2 - - uid: 11576 - components: - - type: Transform - pos: 2.5,44.5 - parent: 2 - - uid: 11577 - components: - - type: Transform - pos: 2.5,43.5 - parent: 2 - - uid: 11578 - components: - - type: Transform - pos: 2.5,42.5 - parent: 2 - - uid: 11579 - components: - - type: Transform - pos: 2.5,41.5 - parent: 2 - - uid: 11580 - components: - - type: Transform - pos: 2.5,40.5 - parent: 2 - - uid: 11581 - components: - - type: Transform - pos: 2.5,39.5 - parent: 2 - - uid: 11582 - components: - - type: Transform - pos: 2.5,38.5 - parent: 2 - - uid: 11583 - components: - - type: Transform - pos: 2.5,37.5 - parent: 2 - - uid: 11584 - components: - - type: Transform - pos: 2.5,36.5 - parent: 2 - - uid: 11585 - components: - - type: Transform - pos: 1.5,37.5 - parent: 2 - - uid: 11586 - components: - - type: Transform - pos: 1.5,36.5 - parent: 2 - - uid: 11587 - components: - - type: Transform - pos: 0.5,40.5 - parent: 2 - - uid: 11588 - components: - - type: Transform - pos: 0.5,42.5 - parent: 2 - - uid: 11589 - components: - - type: Transform - pos: 0.5,43.5 - parent: 2 - - uid: 11590 - components: - - type: Transform - pos: 3.5,43.5 - parent: 2 - - uid: 11591 - components: - - type: Transform - pos: 3.5,42.5 - parent: 2 - - uid: 11592 - components: - - type: Transform - pos: 3.5,41.5 - parent: 2 - - uid: 11596 - components: - - type: Transform - pos: 3.5,37.5 - parent: 2 - - uid: 11597 - components: - - type: Transform - pos: 3.5,36.5 - parent: 2 - - uid: 11599 - components: - - type: Transform - pos: 4.5,37.5 - parent: 2 - - uid: 11600 - components: - - type: Transform - pos: 4.5,38.5 - parent: 2 - - uid: 11602 - components: - - type: Transform - pos: 4.5,40.5 - parent: 2 - - uid: 11603 - components: - - type: Transform - pos: 4.5,41.5 - parent: 2 - - uid: 11604 - components: - - type: Transform - pos: 5.5,39.5 - parent: 2 - - uid: 11606 - components: - - type: Transform - pos: 5.5,37.5 - parent: 2 - - uid: 11607 - components: - - type: Transform - pos: 5.5,36.5 - parent: 2 - - uid: 11608 - components: - - type: Transform - pos: 6.5,39.5 - parent: 2 - - uid: 11609 - components: - - type: Transform - pos: 6.5,38.5 - parent: 2 - - uid: 11611 - components: - - type: Transform - pos: 6.5,36.5 - parent: 2 - - uid: 11615 - components: - - type: Transform - pos: 7.5,35.5 - parent: 2 - - uid: 11616 - components: - - type: Transform - pos: 6.5,35.5 - parent: 2 - - uid: 11618 - components: - - type: Transform - pos: 11.5,36.5 - parent: 2 - uid: 11619 components: - type: Transform pos: 18.5,-3.5 parent: 2 - - uid: 11620 - components: - - type: Transform - pos: 12.5,33.5 - parent: 2 - - uid: 11621 - components: - - type: Transform - pos: 12.5,34.5 - parent: 2 - - uid: 11623 - components: - - type: Transform - pos: 12.5,36.5 - parent: 2 - - uid: 11625 - components: - - type: Transform - pos: 11.5,37.5 - parent: 2 - - uid: 11626 - components: - - type: Transform - pos: 7.5,37.5 - parent: 2 - - uid: 11627 - components: - - type: Transform - pos: 11.5,38.5 - parent: 2 - - uid: 11628 - components: - - type: Transform - pos: 11.5,39.5 - parent: 2 - - uid: 11629 - components: - - type: Transform - pos: 11.5,40.5 - parent: 2 - - uid: 11632 - components: - - type: Transform - pos: 10.5,40.5 - parent: 2 - - uid: 11633 - components: - - type: Transform - pos: 10.5,39.5 - parent: 2 - - uid: 11635 - components: - - type: Transform - pos: 10.5,37.5 - parent: 2 - - uid: 11636 - components: - - type: Transform - pos: 9.5,38.5 - parent: 2 - - uid: 11641 - components: - - type: Transform - pos: 13.5,33.5 - parent: 2 - - uid: 11642 - components: - - type: Transform - pos: 12.5,32.5 - parent: 2 - uid: 11643 components: - type: Transform @@ -66393,11 +70265,6 @@ entities: - type: Transform pos: -20.5,23.5 parent: 2 - - uid: 11664 - components: - - type: Transform - pos: 6.5,34.5 - parent: 2 - uid: 11665 components: - type: Transform @@ -66428,11 +70295,6 @@ entities: - type: Transform pos: 17.5,-7.5 parent: 2 - - uid: 11689 - components: - - type: Transform - pos: -59.5,20.5 - parent: 2 - uid: 11693 components: - type: Transform @@ -66828,11 +70690,6 @@ entities: - type: Transform pos: -58.5,39.5 parent: 2 - - uid: 11826 - components: - - type: Transform - pos: -60.5,33.5 - parent: 2 - uid: 11828 components: - type: Transform @@ -66858,41 +70715,11 @@ entities: - type: Transform pos: -58.5,35.5 parent: 2 - - uid: 11842 - components: - - type: Transform - pos: -59.5,33.5 - parent: 2 - - uid: 11845 - components: - - type: Transform - pos: -55.5,17.5 - parent: 2 - - uid: 11848 - components: - - type: Transform - pos: -54.5,18.5 - parent: 2 - - uid: 11883 - components: - - type: Transform - pos: -55.5,22.5 - parent: 2 - - uid: 11884 - components: - - type: Transform - pos: -55.5,18.5 - parent: 2 - uid: 11889 components: - type: Transform pos: -55.5,43.5 parent: 2 - - uid: 11891 - components: - - type: Transform - pos: -57.5,22.5 - parent: 2 - uid: 11899 components: - type: Transform @@ -66903,31 +70730,11 @@ entities: - type: Transform pos: -58.5,29.5 parent: 2 - - uid: 11904 - components: - - type: Transform - pos: -54.5,17.5 - parent: 2 - - uid: 11905 - components: - - type: Transform - pos: -52.5,17.5 - parent: 2 - - uid: 11906 - components: - - type: Transform - pos: -54.5,16.5 - parent: 2 - uid: 11908 components: - type: Transform pos: -54.5,15.5 parent: 2 - - uid: 11910 - components: - - type: Transform - pos: -56.5,17.5 - parent: 2 - uid: 11911 components: - type: Transform @@ -68288,11 +72095,6 @@ entities: - type: Transform pos: -42.5,35.5 parent: 2 - - uid: 12511 - components: - - type: Transform - pos: -61.5,26.5 - parent: 2 - uid: 12723 components: - type: Transform @@ -68308,11 +72110,6 @@ entities: - type: Transform pos: -57.5,38.5 parent: 2 - - uid: 12786 - components: - - type: Transform - pos: -61.5,27.5 - parent: 2 - uid: 12794 components: - type: Transform @@ -68368,6 +72165,16 @@ entities: - type: Transform pos: -54.5,44.5 parent: 2 + - uid: 14689 + components: + - type: Transform + pos: -52.5,15.5 + parent: 2 + - uid: 14703 + components: + - type: Transform + pos: -52.5,14.5 + parent: 2 - uid: 14760 components: - type: Transform @@ -68438,55 +72245,1373 @@ entities: - type: Transform pos: 1.5,-40.5 parent: 2 -- proto: GunSafe - entities: - - uid: 5947 + - uid: 14826 components: - type: Transform - pos: 9.5,15.5 + pos: -74.5,22.5 parent: 2 - - type: PointLight - color: '#D56C6CFF' - enabled: True - - type: EntityStorage - air: - volume: 200 - immutable: False - temperature: 293.14673 - moles: - - 1.7459903 - - 6.568249 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - 0 - - type: ContainerContainer - containers: - entity_storage: !type:Container - showEnts: False - occludes: True - ents: - - 11454 - - 8734 - - 5762 - paper_label: !type:ContainerSlot - showEnts: False - occludes: True - ent: null + - uid: 14931 + components: + - type: Transform + pos: -63.5,22.5 + parent: 2 + - uid: 14933 + components: + - type: Transform + pos: -63.5,19.5 + parent: 2 + - uid: 15240 + components: + - type: Transform + pos: -59.5,17.5 + parent: 2 + - uid: 15242 + components: + - type: Transform + pos: -69.5,22.5 + parent: 2 + - uid: 15243 + components: + - type: Transform + pos: -64.5,19.5 + parent: 2 + - uid: 15244 + components: + - type: Transform + pos: -63.5,21.5 + parent: 2 + - uid: 15245 + components: + - type: Transform + pos: -63.5,20.5 + parent: 2 + - uid: 15261 + components: + - type: Transform + pos: -63.5,18.5 + parent: 2 + - uid: 15262 + components: + - type: Transform + pos: -68.5,21.5 + parent: 2 + - uid: 15272 + components: + - type: Transform + pos: -59.5,18.5 + parent: 2 + - uid: 15275 + components: + - type: Transform + pos: -58.5,17.5 + parent: 2 + - uid: 15276 + components: + - type: Transform + pos: -60.5,18.5 + parent: 2 + - uid: 15277 + components: + - type: Transform + pos: -58.5,15.5 + parent: 2 + - uid: 15289 + components: + - type: Transform + pos: -65.5,20.5 + parent: 2 + - uid: 15290 + components: + - type: Transform + pos: -65.5,21.5 + parent: 2 + - uid: 15292 + components: + - type: Transform + pos: -68.5,22.5 + parent: 2 + - uid: 15299 + components: + - type: Transform + pos: -58.5,18.5 + parent: 2 + - uid: 15301 + components: + - type: Transform + pos: -58.5,16.5 + parent: 2 + - uid: 15302 + components: + - type: Transform + pos: -62.5,18.5 + parent: 2 + - uid: 15305 + components: + - type: Transform + pos: -64.5,22.5 + parent: 2 + - uid: 15307 + components: + - type: Transform + pos: -66.5,21.5 + parent: 2 + - uid: 15308 + components: + - type: Transform + pos: -66.5,22.5 + parent: 2 + - uid: 15314 + components: + - type: Transform + pos: -67.5,22.5 + parent: 2 + - uid: 15319 + components: + - type: Transform + pos: -75.5,22.5 + parent: 2 + - uid: 15321 + components: + - type: Transform + pos: -76.5,21.5 + parent: 2 + - uid: 15323 + components: + - type: Transform + pos: -70.5,22.5 + parent: 2 + - uid: 15326 + components: + - type: Transform + pos: -71.5,22.5 + parent: 2 + - uid: 15328 + components: + - type: Transform + pos: -73.5,21.5 + parent: 2 + - uid: 15331 + components: + - type: Transform + pos: -72.5,21.5 + parent: 2 + - uid: 15332 + components: + - type: Transform + pos: -73.5,22.5 + parent: 2 + - uid: 15334 + components: + - type: Transform + pos: -74.5,21.5 + parent: 2 + - uid: 15337 + components: + - type: Transform + pos: -77.5,22.5 + parent: 2 + - uid: 15383 + components: + - type: Transform + pos: -77.5,21.5 + parent: 2 + - uid: 15384 + components: + - type: Transform + pos: -78.5,21.5 + parent: 2 + - uid: 15385 + components: + - type: Transform + pos: -79.5,21.5 + parent: 2 + - uid: 15386 + components: + - type: Transform + pos: -78.5,22.5 + parent: 2 + - uid: 15387 + components: + - type: Transform + pos: -79.5,22.5 + parent: 2 + - uid: 15388 + components: + - type: Transform + pos: -80.5,22.5 + parent: 2 + - uid: 15389 + components: + - type: Transform + pos: -79.5,23.5 + parent: 2 + - uid: 15390 + components: + - type: Transform + pos: -80.5,23.5 + parent: 2 + - uid: 15391 + components: + - type: Transform + pos: -81.5,23.5 + parent: 2 + - uid: 15392 + components: + - type: Transform + pos: -79.5,24.5 + parent: 2 + - uid: 15393 + components: + - type: Transform + pos: -79.5,25.5 + parent: 2 + - uid: 15395 + components: + - type: Transform + pos: -79.5,27.5 + parent: 2 + - uid: 15396 + components: + - type: Transform + pos: -79.5,28.5 + parent: 2 + - uid: 15397 + components: + - type: Transform + pos: -79.5,29.5 + parent: 2 + - uid: 15398 + components: + - type: Transform + pos: -82.5,25.5 + parent: 2 + - uid: 15399 + components: + - type: Transform + pos: -82.5,26.5 + parent: 2 + - uid: 15400 + components: + - type: Transform + pos: -82.5,27.5 + parent: 2 + - uid: 15401 + components: + - type: Transform + pos: -82.5,28.5 + parent: 2 + - uid: 15403 + components: + - type: Transform + pos: -80.5,25.5 + parent: 2 + - uid: 15404 + components: + - type: Transform + pos: -80.5,26.5 + parent: 2 + - uid: 15405 + components: + - type: Transform + pos: -80.5,27.5 + parent: 2 + - uid: 15406 + components: + - type: Transform + pos: -80.5,28.5 + parent: 2 + - uid: 15407 + components: + - type: Transform + pos: -81.5,24.5 + parent: 2 + - uid: 15408 + components: + - type: Transform + pos: -81.5,25.5 + parent: 2 + - uid: 15409 + components: + - type: Transform + pos: -81.5,26.5 + parent: 2 + - uid: 15411 + components: + - type: Transform + pos: -81.5,28.5 + parent: 2 + - uid: 15412 + components: + - type: Transform + pos: -82.5,24.5 + parent: 2 + - uid: 15413 + components: + - type: Transform + pos: -83.5,27.5 + parent: 2 + - uid: 15414 + components: + - type: Transform + pos: -83.5,28.5 + parent: 2 + - uid: 15415 + components: + - type: Transform + pos: -83.5,29.5 + parent: 2 + - uid: 15416 + components: + - type: Transform + pos: -83.5,30.5 + parent: 2 + - uid: 15417 + components: + - type: Transform + pos: -82.5,31.5 + parent: 2 + - uid: 15418 + components: + - type: Transform + pos: -82.5,32.5 + parent: 2 + - uid: 15419 + components: + - type: Transform + pos: -82.5,33.5 + parent: 2 + - uid: 15420 + components: + - type: Transform + pos: -82.5,34.5 + parent: 2 + - uid: 15421 + components: + - type: Transform + pos: -82.5,35.5 + parent: 2 + - uid: 15423 + components: + - type: Transform + pos: -82.5,37.5 + parent: 2 + - uid: 15424 + components: + - type: Transform + pos: -81.5,29.5 + parent: 2 + - uid: 15425 + components: + - type: Transform + pos: -81.5,30.5 + parent: 2 + - uid: 15426 + components: + - type: Transform + pos: -81.5,31.5 + parent: 2 + - uid: 15427 + components: + - type: Transform + pos: -81.5,32.5 + parent: 2 + - uid: 15428 + components: + - type: Transform + pos: -81.5,33.5 + parent: 2 + - uid: 15429 + components: + - type: Transform + pos: -81.5,34.5 + parent: 2 + - uid: 15430 + components: + - type: Transform + pos: -81.5,35.5 + parent: 2 + - uid: 15431 + components: + - type: Transform + pos: -81.5,36.5 + parent: 2 + - uid: 15432 + components: + - type: Transform + pos: -81.5,37.5 + parent: 2 + - uid: 15433 + components: + - type: Transform + pos: -82.5,29.5 + parent: 2 + - uid: 15435 + components: + - type: Transform + pos: -83.5,33.5 + parent: 2 + - uid: 15437 + components: + - type: Transform + pos: -83.5,31.5 + parent: 2 + - uid: 15439 + components: + - type: Transform + pos: -79.5,38.5 + parent: 2 + - uid: 15440 + components: + - type: Transform + pos: -79.5,39.5 + parent: 2 + - uid: 15441 + components: + - type: Transform + pos: -79.5,40.5 + parent: 2 + - uid: 15442 + components: + - type: Transform + pos: -81.5,38.5 + parent: 2 + - uid: 15443 + components: + - type: Transform + pos: -80.5,40.5 + parent: 2 + - uid: 15445 + components: + - type: Transform + pos: -80.5,38.5 + parent: 2 + - uid: 15446 + components: + - type: Transform + pos: -78.5,39.5 + parent: 2 + - uid: 15448 + components: + - type: Transform + pos: -79.5,41.5 + parent: 2 + - uid: 15449 + components: + - type: Transform + pos: -79.5,42.5 + parent: 2 + - uid: 15451 + components: + - type: Transform + pos: -78.5,42.5 + parent: 2 + - uid: 15452 + components: + - type: Transform + pos: -77.5,41.5 + parent: 2 + - uid: 15453 + components: + - type: Transform + pos: -77.5,42.5 + parent: 2 + - uid: 15454 + components: + - type: Transform + pos: -76.5,41.5 + parent: 2 + - uid: 15455 + components: + - type: Transform + pos: -76.5,42.5 + parent: 2 + - uid: 15456 + components: + - type: Transform + pos: -75.5,41.5 + parent: 2 + - uid: 15458 + components: + - type: Transform + pos: -74.5,41.5 + parent: 2 + - uid: 15459 + components: + - type: Transform + pos: -74.5,42.5 + parent: 2 + - uid: 15460 + components: + - type: Transform + pos: -73.5,41.5 + parent: 2 + - uid: 15461 + components: + - type: Transform + pos: -73.5,42.5 + parent: 2 + - uid: 15463 + components: + - type: Transform + pos: -72.5,42.5 + parent: 2 + - uid: 15465 + components: + - type: Transform + pos: -71.5,42.5 + parent: 2 + - uid: 15466 + components: + - type: Transform + pos: -70.5,41.5 + parent: 2 + - uid: 15467 + components: + - type: Transform + pos: -70.5,42.5 + parent: 2 + - uid: 15468 + components: + - type: Transform + pos: -69.5,41.5 + parent: 2 + - uid: 15470 + components: + - type: Transform + pos: -68.5,41.5 + parent: 2 + - uid: 15471 + components: + - type: Transform + pos: -68.5,42.5 + parent: 2 + - uid: 15472 + components: + - type: Transform + pos: -67.5,41.5 + parent: 2 + - uid: 15473 + components: + - type: Transform + pos: -67.5,42.5 + parent: 2 + - uid: 15474 + components: + - type: Transform + pos: -66.5,41.5 + parent: 2 + - uid: 15475 + components: + - type: Transform + pos: -66.5,42.5 + parent: 2 + - uid: 15476 + components: + - type: Transform + pos: -65.5,41.5 + parent: 2 + - uid: 15477 + components: + - type: Transform + pos: -65.5,42.5 + parent: 2 + - uid: 15478 + components: + - type: Transform + pos: -77.5,43.5 + parent: 2 + - uid: 15480 + components: + - type: Transform + pos: -75.5,43.5 + parent: 2 + - uid: 15481 + components: + - type: Transform + pos: -74.5,43.5 + parent: 2 + - uid: 15482 + components: + - type: Transform + pos: -73.5,43.5 + parent: 2 + - uid: 15484 + components: + - type: Transform + pos: -71.5,43.5 + parent: 2 + - uid: 15485 + components: + - type: Transform + pos: -70.5,43.5 + parent: 2 + - uid: 15486 + components: + - type: Transform + pos: -69.5,43.5 + parent: 2 + - uid: 15487 + components: + - type: Transform + pos: -68.5,43.5 + parent: 2 + - uid: 15488 + components: + - type: Transform + pos: -67.5,43.5 + parent: 2 + - uid: 15490 + components: + - type: Transform + pos: -65.5,43.5 + parent: 2 + - uid: 15491 + components: + - type: Transform + pos: -64.5,41.5 + parent: 2 + - uid: 15493 + components: + - type: Transform + pos: -64.5,39.5 + parent: 2 + - uid: 15494 + components: + - type: Transform + pos: -64.5,38.5 + parent: 2 + - uid: 15495 + components: + - type: Transform + pos: -65.5,37.5 + parent: 2 + - uid: 15496 + components: + - type: Transform + pos: -65.5,38.5 + parent: 2 + - uid: 15497 + components: + - type: Transform + pos: -65.5,39.5 + parent: 2 + - uid: 15498 + components: + - type: Transform + pos: -65.5,40.5 + parent: 2 + - uid: 15499 + components: + - type: Transform + pos: -66.5,39.5 + parent: 2 + - uid: 15500 + components: + - type: Transform + pos: -66.5,38.5 + parent: 2 + - uid: 15501 + components: + - type: Transform + pos: -63.5,30.5 + parent: 2 + - uid: 15502 + components: + - type: Transform + pos: -63.5,29.5 + parent: 2 + - uid: 15503 + components: + - type: Transform + pos: -63.5,28.5 + parent: 2 + - uid: 15504 + components: + - type: Transform + pos: -62.5,40.5 + parent: 2 + - uid: 15505 + components: + - type: Transform + pos: -62.5,39.5 + parent: 2 + - uid: 15506 + components: + - type: Transform + pos: -62.5,38.5 + parent: 2 + - uid: 15507 + components: + - type: Transform + pos: -62.5,37.5 + parent: 2 + - uid: 15509 + components: + - type: Transform + pos: -62.5,35.5 + parent: 2 + - uid: 15510 + components: + - type: Transform + pos: -62.5,32.5 + parent: 2 + - uid: 15511 + components: + - type: Transform + pos: -62.5,31.5 + parent: 2 + - uid: 15513 + components: + - type: Transform + pos: -61.5,32.5 + parent: 2 + - uid: 15515 + components: + - type: Transform + pos: -62.5,29.5 + parent: 2 + - uid: 15516 + components: + - type: Transform + pos: -62.5,28.5 + parent: 2 + - uid: 15517 + components: + - type: Transform + pos: -63.5,40.5 + parent: 2 + - uid: 15519 + components: + - type: Transform + pos: -63.5,38.5 + parent: 2 + - uid: 15520 + components: + - type: Transform + pos: -63.5,37.5 + parent: 2 + - uid: 15521 + components: + - type: Transform + pos: -63.5,36.5 + parent: 2 + - uid: 15523 + components: + - type: Transform + pos: -63.5,34.5 + parent: 2 + - uid: 15524 + components: + - type: Transform + pos: -63.5,33.5 + parent: 2 + - uid: 15525 + components: + - type: Transform + pos: -63.5,32.5 + parent: 2 + - uid: 15526 + components: + - type: Transform + pos: -63.5,31.5 + parent: 2 + - uid: 15527 + components: + - type: Transform + pos: -64.5,28.5 + parent: 2 + - uid: 15528 + components: + - type: Transform + pos: -65.5,28.5 + parent: 2 + - uid: 15534 + components: + - type: Transform + pos: -61.5,36.5 + parent: 2 + - uid: 15535 + components: + - type: Transform + pos: -61.5,37.5 + parent: 2 + - uid: 15537 + components: + - type: Transform + pos: -60.5,36.5 + parent: 2 + - uid: 15539 + components: + - type: Transform + pos: -59.5,38.5 + parent: 2 + - uid: 15540 + components: + - type: Transform + pos: -59.5,40.5 + parent: 2 + - uid: 15544 + components: + - type: Transform + pos: -65.5,29.5 + parent: 2 + - uid: 15610 + components: + - type: Transform + pos: -79.5,37.5 + parent: 2 + - uid: 15651 + components: + - type: Transform + pos: -0.5,34.5 + parent: 2 + - uid: 15795 + components: + - type: Transform + pos: -1.5,34.5 + parent: 2 + - uid: 15797 + components: + - type: Transform + pos: -2.5,34.5 + parent: 2 + - uid: 15798 + components: + - type: Transform + pos: -2.5,35.5 + parent: 2 + - uid: 15799 + components: + - type: Transform + pos: -2.5,36.5 + parent: 2 + - uid: 15800 + components: + - type: Transform + pos: -2.5,37.5 + parent: 2 + - uid: 15801 + components: + - type: Transform + pos: -2.5,38.5 + parent: 2 + - uid: 15802 + components: + - type: Transform + pos: -2.5,39.5 + parent: 2 + - uid: 15804 + components: + - type: Transform + pos: -3.5,37.5 + parent: 2 + - uid: 15806 + components: + - type: Transform + pos: -3.5,39.5 + parent: 2 + - uid: 15807 + components: + - type: Transform + pos: -3.5,40.5 + parent: 2 + - uid: 15808 + components: + - type: Transform + pos: -3.5,41.5 + parent: 2 + - uid: 15810 + components: + - type: Transform + pos: -3.5,43.5 + parent: 2 + - uid: 15811 + components: + - type: Transform + pos: -1.5,41.5 + parent: 2 + - uid: 15812 + components: + - type: Transform + pos: -1.5,42.5 + parent: 2 + - uid: 15813 + components: + - type: Transform + pos: -1.5,43.5 + parent: 2 + - uid: 15814 + components: + - type: Transform + pos: -2.5,41.5 + parent: 2 + - uid: 15815 + components: + - type: Transform + pos: -2.5,42.5 + parent: 2 + - uid: 15816 + components: + - type: Transform + pos: -2.5,43.5 + parent: 2 + - uid: 15817 + components: + - type: Transform + pos: -1.5,44.5 + parent: 2 + - uid: 15818 + components: + - type: Transform + pos: -1.5,45.5 + parent: 2 + - uid: 15819 + components: + - type: Transform + pos: -0.5,44.5 + parent: 2 + - uid: 15820 + components: + - type: Transform + pos: -0.5,45.5 + parent: 2 + - uid: 15821 + components: + - type: Transform + pos: 0.5,44.5 + parent: 2 + - uid: 15822 + components: + - type: Transform + pos: 0.5,45.5 + parent: 2 + - uid: 15823 + components: + - type: Transform + pos: 1.5,44.5 + parent: 2 + - uid: 15824 + components: + - type: Transform + pos: 1.5,45.5 + parent: 2 + - uid: 15825 + components: + - type: Transform + pos: 2.5,44.5 + parent: 2 + - uid: 15826 + components: + - type: Transform + pos: 2.5,45.5 + parent: 2 + - uid: 15827 + components: + - type: Transform + pos: 3.5,44.5 + parent: 2 + - uid: 15828 + components: + - type: Transform + pos: 3.5,45.5 + parent: 2 + - uid: 15829 + components: + - type: Transform + pos: 4.5,44.5 + parent: 2 + - uid: 15830 + components: + - type: Transform + pos: 10.5,45.5 + parent: 2 + - uid: 15831 + components: + - type: Transform + pos: 11.5,44.5 + parent: 2 + - uid: 15833 + components: + - type: Transform + pos: 12.5,44.5 + parent: 2 + - uid: 15834 + components: + - type: Transform + pos: 12.5,45.5 + parent: 2 + - uid: 15835 + components: + - type: Transform + pos: 4.5,45.5 + parent: 2 + - uid: 15836 + components: + - type: Transform + pos: 5.5,44.5 + parent: 2 + - uid: 15837 + components: + - type: Transform + pos: 5.5,45.5 + parent: 2 + - uid: 15838 + components: + - type: Transform + pos: 6.5,44.5 + parent: 2 + - uid: 15839 + components: + - type: Transform + pos: 6.5,45.5 + parent: 2 + - uid: 15840 + components: + - type: Transform + pos: 7.5,44.5 + parent: 2 + - uid: 15842 + components: + - type: Transform + pos: 8.5,44.5 + parent: 2 + - uid: 15843 + components: + - type: Transform + pos: 8.5,45.5 + parent: 2 + - uid: 15844 + components: + - type: Transform + pos: 9.5,44.5 + parent: 2 + - uid: 15845 + components: + - type: Transform + pos: 9.5,45.5 + parent: 2 + - uid: 15846 + components: + - type: Transform + pos: 10.5,44.5 + parent: 2 + - uid: 15847 + components: + - type: Transform + pos: 11.5,46.5 + parent: 2 + - uid: 15848 + components: + - type: Transform + pos: 10.5,46.5 + parent: 2 + - uid: 15849 + components: + - type: Transform + pos: 9.5,46.5 + parent: 2 + - uid: 15850 + components: + - type: Transform + pos: 8.5,46.5 + parent: 2 + - uid: 15851 + components: + - type: Transform + pos: 7.5,46.5 + parent: 2 + - uid: 15852 + components: + - type: Transform + pos: 6.5,46.5 + parent: 2 + - uid: 15853 + components: + - type: Transform + pos: 5.5,46.5 + parent: 2 + - uid: 15854 + components: + - type: Transform + pos: 4.5,46.5 + parent: 2 + - uid: 15856 + components: + - type: Transform + pos: 2.5,46.5 + parent: 2 + - uid: 15857 + components: + - type: Transform + pos: 3.5,47.5 + parent: 2 + - uid: 15858 + components: + - type: Transform + pos: 4.5,47.5 + parent: 2 + - uid: 15859 + components: + - type: Transform + pos: 5.5,47.5 + parent: 2 + - uid: 15860 + components: + - type: Transform + pos: 6.5,47.5 + parent: 2 + - uid: 15861 + components: + - type: Transform + pos: 7.5,47.5 + parent: 2 + - uid: 15862 + components: + - type: Transform + pos: 8.5,47.5 + parent: 2 + - uid: 15863 + components: + - type: Transform + pos: 9.5,47.5 + parent: 2 + - uid: 15865 + components: + - type: Transform + pos: 2.5,47.5 + parent: 2 + - uid: 15866 + components: + - type: Transform + pos: 2.5,48.5 + parent: 2 + - uid: 15867 + components: + - type: Transform + pos: 2.5,49.5 + parent: 2 + - uid: 15868 + components: + - type: Transform + pos: 2.5,50.5 + parent: 2 + - uid: 15869 + components: + - type: Transform + pos: 3.5,48.5 + parent: 2 + - uid: 15871 + components: + - type: Transform + pos: -0.5,46.5 + parent: 2 + - uid: 15872 + components: + - type: Transform + pos: 0.5,46.5 + parent: 2 + - uid: 15873 + components: + - type: Transform + pos: 1.5,47.5 + parent: 2 + - uid: 15874 + components: + - type: Transform + pos: 9.5,48.5 + parent: 2 + - uid: 15875 + components: + - type: Transform + pos: 9.5,49.5 + parent: 2 + - uid: 15876 + components: + - type: Transform + pos: 9.5,50.5 + parent: 2 + - uid: 15877 + components: + - type: Transform + pos: 9.5,51.5 + parent: 2 + - uid: 15878 + components: + - type: Transform + pos: 10.5,48.5 + parent: 2 + - uid: 15879 + components: + - type: Transform + pos: 10.5,49.5 + parent: 2 + - uid: 15880 + components: + - type: Transform + pos: 10.5,50.5 + parent: 2 + - uid: 15881 + components: + - type: Transform + pos: 10.5,51.5 + parent: 2 + - uid: 15882 + components: + - type: Transform + pos: 8.5,49.5 + parent: 2 + - uid: 15884 + components: + - type: Transform + pos: 7.5,48.5 + parent: 2 + - uid: 15885 + components: + - type: Transform + pos: 7.5,49.5 + parent: 2 + - uid: 15888 + components: + - type: Transform + pos: 11.5,47.5 + parent: 2 + - uid: 15889 + components: + - type: Transform + pos: 12.5,46.5 + parent: 2 + - uid: 15890 + components: + - type: Transform + pos: 14.5,46.5 + parent: 2 + - uid: 15891 + components: + - type: Transform + pos: 14.5,45.5 + parent: 2 + - uid: 15892 + components: + - type: Transform + pos: 14.5,44.5 + parent: 2 + - uid: 15893 + components: + - type: Transform + pos: 14.5,43.5 + parent: 2 + - uid: 15894 + components: + - type: Transform + pos: 14.5,42.5 + parent: 2 + - uid: 15895 + components: + - type: Transform + pos: 14.5,41.5 + parent: 2 + - uid: 15896 + components: + - type: Transform + pos: 14.5,40.5 + parent: 2 + - uid: 15897 + components: + - type: Transform + pos: 13.5,41.5 + parent: 2 + - uid: 15898 + components: + - type: Transform + pos: 13.5,42.5 + parent: 2 + - uid: 15900 + components: + - type: Transform + pos: 13.5,44.5 + parent: 2 + - uid: 15901 + components: + - type: Transform + pos: 15.5,42.5 + parent: 2 + - uid: 15902 + components: + - type: Transform + pos: 15.5,41.5 + parent: 2 + - uid: 15904 + components: + - type: Transform + pos: 15.5,39.5 + parent: 2 + - uid: 15906 + components: + - type: Transform + pos: 15.5,37.5 + parent: 2 + - uid: 15907 + components: + - type: Transform + pos: 15.5,36.5 + parent: 2 + - uid: 15908 + components: + - type: Transform + pos: 14.5,35.5 + parent: 2 + - uid: 15909 + components: + - type: Transform + pos: 14.5,36.5 + parent: 2 + - uid: 15911 + components: + - type: Transform + pos: 14.5,38.5 + parent: 2 + - uid: 15912 + components: + - type: Transform + pos: 14.5,39.5 + parent: 2 + - uid: 15913 + components: + - type: Transform + pos: 13.5,34.5 + parent: 2 + - uid: 15914 + components: + - type: Transform + pos: 12.5,34.5 + parent: 2 + - uid: 15915 + components: + - type: Transform + pos: 13.5,33.5 + parent: 2 + - uid: 15916 + components: + - type: Transform + pos: 13.5,32.5 + parent: 2 + - uid: 15917 + components: + - type: Transform + pos: 13.5,31.5 + parent: 2 + - uid: 15918 + components: + - type: Transform + pos: 14.5,34.5 + parent: 2 + - uid: 15919 + components: + - type: Transform + pos: 15.5,35.5 + parent: 2 +- proto: GunSafe + entities: - uid: 6720 components: - type: Transform @@ -68501,8 +73626,8 @@ entities: immutable: False temperature: 293.14673 moles: - - 1.7459903 - - 6.568249 + - 1.8968438 + - 7.1357465 - 0 - 0 - 0 @@ -68527,10 +73652,12 @@ entities: showEnts: False occludes: True ents: + - 15993 + - 15992 - 12407 - - 5677 - - 3883 - - 3853 + - 15994 + - 15995 + - 535 paper_label: !type:ContainerSlot showEnts: False occludes: True @@ -68549,8 +73676,8 @@ entities: immutable: False temperature: 293.14673 moles: - - 1.7459903 - - 6.568249 + - 1.8968438 + - 7.1357465 - 0 - 0 - 0 @@ -68575,9 +73702,12 @@ entities: showEnts: False occludes: True ents: - - 12548 - - 5753 - 5760 + - 12548 + - 15028 + - 15027 + - 15026 + - 5753 paper_label: !type:ContainerSlot showEnts: False occludes: True @@ -68596,8 +73726,8 @@ entities: immutable: False temperature: 293.14673 moles: - - 1.7459903 - - 6.568249 + - 1.8856695 + - 7.0937095 - 0 - 0 - 0 @@ -68628,10 +73758,34 @@ entities: showEnts: False occludes: True ent: null - - uid: 13129 + - uid: 15037 components: - type: Transform - pos: 8.5,19.5 + pos: 11.5,19.5 + parent: 2 + - type: PointLight + color: '#D56C6CFF' + enabled: True + - type: ContainerContainer + containers: + entity_storage: !type:Container + showEnts: False + occludes: True + ents: + - 15043 + - 15042 + - 15041 + - 15040 + - 15039 + - 15038 + paper_label: !type:ContainerSlot + showEnts: False + occludes: True + ent: null + - uid: 15046 + components: + - type: Transform + pos: 11.5,15.5 parent: 2 - type: PointLight color: '#D56C6CFF' @@ -68668,12 +73822,10 @@ entities: showEnts: False occludes: True ents: - - 555 - - 586 - - 588 - - 12552 - - 12414 - - 12458 + - 12489 + - 12395 + - 15047 + - 15048 paper_label: !type:ContainerSlot showEnts: False occludes: True @@ -68726,7 +73878,7 @@ entities: - uid: 6893 components: - type: Transform - pos: -35.632256,-16.132172 + pos: -35.54158,-16.203033 parent: 2 - proto: HandHeldMassScanner entities: @@ -68747,6 +73899,11 @@ entities: - type: Transform pos: -20.239948,-11.39951 parent: 2 + - uid: 15660 + components: + - type: Transform + pos: 12.806734,38.926914 + parent: 2 - proto: HandLabeler entities: - uid: 6617 @@ -68759,12 +73916,20 @@ entities: - type: Transform pos: -35.447105,-4.532789 parent: 2 -- proto: HighSecArmoryLocked +- proto: HarmonicaInstrument entities: - - uid: 939 + - uid: 562 components: - type: Transform - pos: 7.5,17.5 + pos: 4.4752083,40.89765 + parent: 2 +- proto: HighSecArmoryLocked + entities: + - uid: 15228 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 8.5,17.5 parent: 2 - proto: HighSecCommandLocked entities: @@ -68809,17 +73974,6 @@ entities: - type: Transform pos: -45.404816,2.6740484 parent: 2 -- proto: HospitalCurtains - entities: - - uid: 5839 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 4.5,33.5 - parent: 2 - - type: Door - secondsUntilStateChange: -79174.07 - state: Opening - proto: HospitalCurtainsOpen entities: - uid: 6375 @@ -68884,30 +74038,6 @@ entities: currentPrototype: HydrogenCanister - proto: hydroponicsSoil entities: - - uid: 5843 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 9.5,30.5 - parent: 2 - - uid: 5844 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 9.5,29.5 - parent: 2 - - uid: 5845 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 10.5,30.5 - parent: 2 - - uid: 5846 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 10.5,29.5 - parent: 2 - uid: 6541 components: - type: Transform @@ -68923,22 +74053,35 @@ entities: - type: Transform pos: -42.5,-52.5 parent: 2 -- proto: HydroponicsToolMiniHoe +- proto: HydroponicsToolClippers entities: - - uid: 13070 + - uid: 11580 components: - type: Transform - pos: 9.843569,30.06581 + pos: 12.494478,38.416866 + parent: 2 +- proto: HydroponicsToolMiniHoe + entities: + - uid: 14419 + components: + - type: Transform + pos: 12.561471,38.60821 parent: 2 - proto: HydroponicsToolSpade entities: - - uid: 5856 + - uid: 11597 components: - type: Transform - pos: 8.4413,29.364113 + pos: 12.379921,39.002365 parent: 2 - proto: hydroponicsTray entities: + - uid: 4441 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 12.5,36.5 + parent: 2 - uid: 6739 components: - type: Transform @@ -68993,6 +74136,18 @@ entities: rot: 1.5707963267948966 rad pos: -18.5,-10.5 parent: 2 + - uid: 11621 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 12.5,37.5 + parent: 2 + - uid: 12560 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 11.5,36.5 + parent: 2 - proto: InflatableWall entities: - uid: 9619 @@ -69039,6 +74194,14 @@ entities: parent: 2 missingComponents: - ActiveListener + - uid: 15171 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -71.5,33.5 + parent: 2 + missingComponents: + - ActiveListener - proto: JanitorialTrolley entities: - uid: 8321 @@ -69128,34 +74291,88 @@ entities: - type: DeviceLinkSink links: - 12483 -- proto: JetpackMiniFilled - entities: - - uid: 8147 + - uid: 15933 components: - type: Transform - pos: -53.416973,-5.6205897 + rot: -1.5707963267948966 rad + pos: 10.5,34.5 parent: 2 - - uid: 8148 + - type: DeviceLinkSink + links: + - 5918 + - uid: 15936 components: - type: Transform - pos: -53.4326,-5.2768397 + rot: -1.5707963267948966 rad + pos: 10.5,35.5 + parent: 2 + - type: DeviceLinkSink + links: + - 5917 + - uid: 15937 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 1.5,34.5 + parent: 2 + - type: DeviceLinkSink + links: + - 11592 + - uid: 15938 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 1.5,35.5 + parent: 2 + - type: DeviceLinkSink + links: + - 12239 +- proto: JetpackBlueFilled + entities: + - uid: 8290 + components: + - type: Transform + pos: -53.615463,-5.3059483 + parent: 2 + - uid: 9496 + components: + - type: Transform + pos: -53.40442,-5.4782987 parent: 2 - proto: JetpackSecurityFilled entities: - - uid: 5714 + - uid: 15204 components: - type: Transform - parent: 5713 - - type: Physics - canCollide: False - - type: InsideEntityStorage - - uid: 5726 + pos: 11.672285,18.787407 + parent: 2 + - type: GasTank + toggleActionEntity: 8732 + - type: Jetpack + toggleActionEntity: 8453 + - type: ActionsContainer + - type: ContainerContainer + containers: + actions: !type:Container + ents: + - 8453 + - 8732 + - uid: 15209 components: - type: Transform - parent: 5713 - - type: Physics - canCollide: False - - type: InsideEntityStorage + pos: 11.374752,18.70501 + parent: 2 + - type: GasTank + toggleActionEntity: 15983 + - type: Jetpack + toggleActionEntity: 15982 + - type: ActionsContainer + - type: ContainerContainer + containers: + actions: !type:Container + ents: + - 15982 + - 15983 - proto: JetpackVoidFilled entities: - uid: 13667 @@ -69204,23 +74421,42 @@ entities: - type: Transform pos: -49.33561,-31.361881 parent: 2 -- proto: KitchenMicrowave +- proto: KitchenElectricGrill entities: - - uid: 863 + - uid: 16004 components: - type: Transform pos: -16.5,-15.5 parent: 2 - - uid: 5852 +- proto: KitchenKnife + entities: + - uid: 15841 components: - type: Transform - pos: 8.5,32.5 + pos: 7.587607,45.49134 parent: 2 - - uid: 9094 + - uid: 16009 + components: + - type: Transform + pos: -17.715347,-15.321278 + parent: 2 +- proto: KitchenMicrowave + entities: + - uid: 626 components: - type: Transform pos: -17.5,-13.5 parent: 2 + - uid: 1016 + components: + - type: Transform + pos: -16.5,-12.5 + parent: 2 + - uid: 11582 + components: + - type: Transform + pos: -0.5,38.5 + parent: 2 - uid: 12840 components: - type: Transform @@ -69238,6 +74474,11 @@ entities: - type: Transform pos: -35.5,-5.5 parent: 2 + - uid: 11591 + components: + - type: Transform + pos: 0.5,36.5 + parent: 2 - proto: KitchenSpike entities: - uid: 6681 @@ -69245,6 +74486,14 @@ entities: - type: Transform pos: -14.5,-10.5 parent: 2 +- proto: KnifePlastic + entities: + - uid: 13558 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -0.47632122,37.730453 + parent: 2 - proto: KoboldCubeBox entities: - uid: 7177 @@ -69315,6 +74564,27 @@ entities: rot: 1.5707963267948966 rad pos: 1.8024639,19.985035 parent: 2 + - uid: 15965 + components: + - type: Transform + pos: 7.6150637,34.84648 + parent: 2 + - type: HandheldLight + toggleActionEntity: 15966 + - type: ContainerContainer + containers: + cell_slot: !type:ContainerSlot + showEnts: False + occludes: True + ent: null + actions: !type:Container + showEnts: False + occludes: True + ents: + - 15966 + - type: Physics + canCollide: True + - type: ActionsContainer - proto: LampGold entities: - uid: 597 @@ -69364,6 +74634,29 @@ entities: - type: Physics canCollide: True - type: ActionsContainer +- proto: LampInterrogator + entities: + - uid: 541 + components: + - type: Transform + pos: 0.49678588,15.737576 + parent: 2 + - type: HandheldLight + toggleActionEntity: 546 + - type: ContainerContainer + containers: + cell_slot: !type:ContainerSlot + showEnts: False + occludes: True + ent: null + actions: !type:Container + showEnts: False + occludes: True + ents: + - 546 + - type: Physics + canCollide: True + - type: ActionsContainer - proto: LandMineAspectExplosive entities: - uid: 14537 @@ -69405,6 +74698,18 @@ entities: - type: Transform pos: -43.5,-45.5 parent: 2 +- proto: LargeBeaker + entities: + - uid: 11603 + components: + - type: Transform + pos: -0.3264783,37.309746 + parent: 2 + - uid: 15625 + components: + - type: Transform + pos: -0.6333525,37.170612 + parent: 2 - proto: LauncherCreamPie entities: - uid: 8986 @@ -69427,6 +74732,50 @@ entities: - type: Transform pos: -55.42559,-14.352307 parent: 2 +- proto: LockableButtonEngineering + entities: + - uid: 15152 + components: + - type: Transform + pos: -64.5,27.5 + parent: 2 + - type: DeviceLinkSource + linkedPorts: + 15153: + - Pressed: Toggle + 15154: + - Pressed: Toggle + 15155: + - Pressed: Toggle + - uid: 15618 + components: + - type: Transform + pos: -67.5,27.5 + parent: 2 + - type: DeviceLinkSource + linkedPorts: + 15153: + - Pressed: Toggle + 15154: + - Pressed: Toggle + 15155: + - Pressed: Toggle + - uid: 15623 + components: + - type: MetaData + name: кнопка сброса газов + - type: Transform + rot: 3.141592653589793 rad + pos: -70.5,27.5 + parent: 2 + - type: DeviceLinkSource + linkedPorts: + 11628: + - Pressed: Toggle + 11632: + - Pressed: Toggle + 11633: + - Pressed: Toggle - proto: LockerAtmosphericsFilled entities: - uid: 14573 @@ -69443,8 +74792,8 @@ entities: immutable: False temperature: 293.14673 moles: - - 1.7459903 - - 6.568249 + - 1.8856695 + - 7.0937095 - 0 - 0 - 0 @@ -69469,11 +74818,12 @@ entities: showEnts: False occludes: True ents: + - 12237 - 14578 - 14576 - - 14575 - - 14574 - 14577 + - 14574 + - 14575 paper_label: !type:ContainerSlot showEnts: False occludes: True @@ -69492,8 +74842,8 @@ entities: immutable: False temperature: 293.14673 moles: - - 1.7459903 - - 6.568249 + - 1.8856695 + - 7.0937095 - 0 - 0 - 0 @@ -69523,6 +74873,7 @@ entities: - 14636 - 14635 - 14638 + - 14092 paper_label: !type:ContainerSlot showEnts: False occludes: True @@ -69740,6 +75091,32 @@ entities: - type: PointLight color: '#D56C6CFF' enabled: True + - type: EntityStorage + air: + volume: 200 + immutable: False + temperature: 293.14673 + moles: + - 1.7459903 + - 6.568249 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 - proto: LockerClownFilled entities: - uid: 3534 @@ -69832,6 +75209,194 @@ entities: enabled: True - proto: LockerEvidence entities: + - uid: 609 + components: + - type: Transform + pos: 10.5,30.5 + parent: 2 + - type: Lock + locked: False + - type: PointLight + color: '#7FC080FF' + enabled: True + - type: EntityStorage + air: + volume: 200 + immutable: False + temperature: 293.14673 + moles: + - 1.7459903 + - 6.568249 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - type: ContainerContainer + containers: + entity_storage: !type:Container + showEnts: False + occludes: True + ents: + - 12696 + paper_label: !type:ContainerSlot + showEnts: False + occludes: True + ent: null + - uid: 885 + components: + - type: Transform + pos: 1.5,29.5 + parent: 2 + - type: Lock + locked: False + - type: PointLight + color: '#7FC080FF' + enabled: True + - type: EntityStorage + air: + volume: 200 + immutable: False + temperature: 293.147 + moles: + - 1.7459903 + - 6.568249 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - type: ContainerContainer + containers: + entity_storage: !type:Container + showEnts: False + occludes: True + ents: + - 12700 + paper_label: !type:ContainerSlot + showEnts: False + occludes: True + ent: null + - uid: 937 + components: + - type: Transform + pos: 1.5,30.5 + parent: 2 + - type: Lock + locked: False + - type: PointLight + color: '#7FC080FF' + enabled: True + - type: EntityStorage + air: + volume: 200 + immutable: False + temperature: 293.147 + moles: + - 1.7459903 + - 6.568249 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - type: ContainerContainer + containers: + entity_storage: !type:Container + showEnts: False + occludes: True + ents: + - 12701 + paper_label: !type:ContainerSlot + showEnts: False + occludes: True + ent: null + - uid: 4442 + components: + - type: Transform + pos: 10.5,29.5 + parent: 2 + - type: Lock + locked: False + - type: PointLight + color: '#7FC080FF' + enabled: True + - type: EntityStorage + air: + volume: 200 + immutable: False + temperature: 293.147 + moles: + - 1.7459903 + - 6.568249 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - type: ContainerContainer + containers: + entity_storage: !type:Container + showEnts: False + occludes: True + ents: + - 12702 + paper_label: !type:ContainerSlot + showEnts: False + occludes: True + ent: null - uid: 6983 components: - type: Transform @@ -69840,25 +75405,9 @@ entities: - type: PointLight color: '#D56C6CFF' enabled: True - - uid: 8736 - components: - - type: Transform - pos: 2.5,9.5 - parent: 2 - - type: PointLight - color: '#D56C6CFF' - enabled: True - - uid: 8737 - components: - - type: Transform - pos: 2.5,15.5 - parent: 2 - - type: PointLight - color: '#D56C6CFF' - enabled: True - proto: LockerFreezer entities: - - uid: 2943 + - uid: 644 components: - type: Transform pos: -16.5,-9.5 @@ -69911,6 +75460,62 @@ entities: showEnts: False occludes: True ent: null + - uid: 15640 + components: + - type: Transform + pos: -0.5,39.5 + parent: 2 + - type: Lock + locked: False + - type: PointLight + color: '#7FC080FF' + enabled: True + - type: EntityStorage + air: + volume: 200 + immutable: False + temperature: 293.1465 + moles: + - 1.7459903 + - 6.568249 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - type: ContainerContainer + containers: + entity_storage: !type:Container + showEnts: False + occludes: True + ents: + - 15649 + - 15648 + - 15641 + - 15642 + - 15643 + - 15644 + - 15645 + - 15646 + - 15647 + - 15650 + paper_label: !type:ContainerSlot + showEnts: False + occludes: True + ent: null - proto: LockerFreezerVaultFilled entities: - uid: 5493 @@ -70175,6 +75780,14 @@ entities: enabled: True - proto: LockerSecurityFilled entities: + - uid: 5601 + components: + - type: Transform + pos: 6.5,7.5 + parent: 2 + - type: PointLight + color: '#D56C6CFF' + enabled: True - uid: 5681 components: - type: Transform @@ -70199,12 +75812,36 @@ entities: - type: PointLight color: '#D56C6CFF' enabled: True -- proto: LockerSyndicatePersonal - entities: - - uid: 5713 + - uid: 14646 components: - type: Transform - pos: 8.5,15.5 + pos: 5.5,7.5 + parent: 2 + - type: PointLight + color: '#D56C6CFF' + enabled: True + - uid: 16001 + components: + - type: Transform + pos: 6.5,14.5 + parent: 2 + - type: PointLight + color: '#D56C6CFF' + enabled: True + - uid: 16002 + components: + - type: Transform + pos: 5.5,14.5 + parent: 2 + - type: PointLight + color: '#D56C6CFF' + enabled: True +- proto: LockerSyndicatePersonal + entities: + - uid: 1019 + components: + - type: Transform + pos: 14.5,-8.5 parent: 2 - type: PointLight color: '#D56C6CFF' @@ -70213,7 +75850,7 @@ entities: air: volume: 200 immutable: False - temperature: 293.14673 + temperature: 293.1465 moles: - 1.7459903 - 6.568249 @@ -70241,22 +75878,69 @@ entities: showEnts: False occludes: True ents: - - 208 - - 213 - - 5641 - - 5726 - - 215 - - 210 - - 5714 - - 5643 - - 232 - - 234 - - 237 - - 239 - - 242 - - 244 - - 5638 - - 5749 + - 1772 + - 1768 + - 1674 + - 1031 + - 1033 + paper_label: !type:ContainerSlot + showEnts: False + occludes: True + ent: null + - uid: 15200 + components: + - type: Transform + pos: 9.5,15.5 + parent: 2 + - type: PointLight + color: '#D56C6CFF' + enabled: True + - type: EntityStorage + air: + volume: 200 + immutable: False + temperature: 293.14697 + moles: + - 1.8856695 + - 7.0937095 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - 0 + - type: ContainerContainer + containers: + entity_storage: !type:Container + showEnts: False + occludes: True + ents: + - 15216 + - 15215 + - 15214 + - 15213 + - 15212 + - 15211 + - 15210 + - 15208 + - 15207 + - 15206 + - 15205 + - 15203 + - 15202 + - 15201 paper_label: !type:ContainerSlot showEnts: False occludes: True @@ -70445,33 +76129,77 @@ entities: - type: Physics canCollide: False - type: InsideEntityStorage + - uid: 15026 + components: + - type: Transform + parent: 6721 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15027 + components: + - type: Transform + parent: 6721 + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: MagazineRifle entities: - - uid: 555 + - uid: 15038 components: - type: Transform - parent: 13129 + parent: 15037 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 586 + - uid: 15039 components: - type: Transform - parent: 13129 + parent: 15037 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 588 + - uid: 15042 components: - type: Transform - parent: 13129 + parent: 15037 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 12552 + - uid: 15043 components: - type: Transform - parent: 13129 + parent: 15037 + - type: Physics + canCollide: False + - type: InsideEntityStorage +- proto: MagazineShotgun + entities: + - uid: 15992 + components: + - type: Transform + parent: 6720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15993 + components: + - type: Transform + parent: 6720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15994 + components: + - type: Transform + parent: 6720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15995 + components: + - type: Transform + parent: 6720 - type: Physics canCollide: False - type: InsideEntityStorage @@ -70566,11 +76294,6 @@ entities: - type: Transform pos: 11.5,23.5 parent: 2 - - uid: 9583 - components: - - type: Transform - pos: 14.5,13.5 - parent: 2 - uid: 9585 components: - type: Transform @@ -70666,11 +76389,6 @@ entities: parent: 2 - proto: MaintenanceWeaponSpawner entities: - - uid: 9564 - components: - - type: Transform - pos: 12.5,-8.5 - parent: 2 - uid: 9568 components: - type: Transform @@ -70691,6 +76409,23 @@ entities: - type: Transform pos: -32.5,-43.5 parent: 2 + - uid: 14717 + components: + - type: Transform + pos: 8.5,-11.5 + parent: 2 + - uid: 14925 + components: + - type: Transform + pos: -54.5,18.5 + parent: 2 +- proto: MakeshiftShield + entities: + - uid: 15855 + components: + - type: Transform + pos: 7.515099,45.473263 + parent: 2 - proto: MarimbaInstrument entities: - uid: 9434 @@ -70705,6 +76440,20 @@ entities: - type: Transform pos: -51.198994,-46.07993 parent: 2 + - uid: 5734 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 5737 + components: + - type: Transform + parent: 15630 + - type: Physics + canCollide: False + - type: InsideEntityStorage - uid: 7975 components: - type: Transform @@ -70724,23 +76473,6 @@ entities: - type: Transform pos: -12.705608,3.715142 parent: 2 -- proto: Mattress - entities: - - uid: 1000 - components: - - type: Transform - pos: 2.5,29.5 - parent: 2 - - uid: 1104 - components: - - type: Transform - pos: 1.5,29.5 - parent: 2 - - uid: 6659 - components: - - type: Transform - pos: 3.5,29.5 - parent: 2 - proto: MedicalBed entities: - uid: 4367 @@ -70794,26 +76526,36 @@ entities: - uid: 11933 components: - type: Transform - pos: 1.5548868,6.477925 + pos: 1.4474392,6.50338 + parent: 2 + - uid: 14829 + components: + - type: Transform + pos: -27.610794,-16.310091 parent: 2 - proto: MedkitAdvancedFilled entities: - uid: 3147 components: - type: Transform - pos: -52.421173,18.568275 + pos: -53.93793,13.433474 parent: 2 - uid: 6896 components: - type: Transform - pos: -35.360886,-15.326273 + pos: -35.451313,-15.350643 parent: 2 -- proto: MedkitBrute +- proto: MedkitBruteFilled entities: - uid: 6912 components: - type: Transform - pos: -28.201515,-16.324797 + pos: -28.219778,-16.255417 + parent: 2 + - uid: 15959 + components: + - type: Transform + pos: 1.5216246,6.816931 parent: 2 - proto: MedkitBurnFilled entities: @@ -70822,12 +76564,17 @@ entities: - type: Transform pos: -28.665678,-16.299198 parent: 2 + - uid: 15960 + components: + - type: Transform + pos: 1.453701,6.7579923 + parent: 2 - proto: MedkitFilled entities: - uid: 5721 components: - type: Transform - pos: 1.4205822,6.786004 + pos: 3.4949512,29.7673 parent: 2 - uid: 6909 components: @@ -70837,7 +76584,7 @@ entities: - uid: 6950 components: - type: Transform - pos: -35.51828,-15.536684 + pos: -35.528374,-15.671108 parent: 2 - uid: 8079 components: @@ -70854,6 +76601,11 @@ entities: - type: Transform pos: -19.521564,19.672852 parent: 2 + - uid: 14828 + components: + - type: Transform + pos: -35.54454,-15.481346 + parent: 2 - proto: MedkitRadiationFilled entities: - uid: 6911 @@ -70861,6 +76613,16 @@ entities: - type: Transform pos: -28.20866,-16.485518 parent: 2 + - uid: 15168 + components: + - type: Transform + pos: -73.5494,24.696754 + parent: 2 + - uid: 15169 + components: + - type: Transform + pos: -73.33292,24.593992 + parent: 2 - proto: MedkitToxinFilled entities: - uid: 6913 @@ -70892,18 +76654,28 @@ entities: - type: Transform pos: -40.5,-30.5 parent: 2 -- proto: MopBucket - entities: - - uid: 5931 + - uid: 15745 components: - type: Transform - pos: 4.5,31.5 + pos: 10.5,43.5 parent: 2 + - uid: 15749 + components: + - type: Transform + pos: 1.5,43.5 + parent: 2 +- proto: MopBucket + entities: - uid: 8308 components: - type: Transform pos: 19.5,15.5 parent: 2 + - uid: 15663 + components: + - type: Transform + pos: 9.5,39.5 + parent: 2 - proto: MopItem entities: - uid: 60 @@ -70911,10 +76683,10 @@ entities: - type: Transform pos: 19.534658,15.456097 parent: 2 - - uid: 5930 + - uid: 11587 components: - type: Transform - pos: 4.230297,31.603271 + pos: 9.516268,39.545895 parent: 2 - uid: 14226 components: @@ -70984,6 +76756,11 @@ entities: - type: Transform pos: -47.378597,13.386821 parent: 2 + - uid: 15170 + components: + - type: Transform + pos: -72.74927,24.588608 + parent: 2 - proto: NetworkConfigurator entities: - uid: 3105 @@ -71054,6 +76831,34 @@ entities: parent: 2 - type: PolymorphableCanister currentPrototype: NitrogenCanister + - uid: 15092 + components: + - type: Transform + pos: -77.5,25.5 + parent: 2 + - type: PolymorphableCanister + currentPrototype: NitrogenCanister + - uid: 15126 + components: + - type: Transform + pos: -77.5,24.5 + parent: 2 + - type: PolymorphableCanister + currentPrototype: NitrogenCanister + - uid: 15131 + components: + - type: Transform + pos: -75.5,25.5 + parent: 2 + - type: PolymorphableCanister + currentPrototype: NitrogenCanister + - uid: 15132 + components: + - type: Transform + pos: -75.5,24.5 + parent: 2 + - type: PolymorphableCanister + currentPrototype: NitrogenCanister - proto: NitrousOxideCanister entities: - uid: 7172 @@ -71358,16 +77163,6 @@ entities: - type: Transform pos: 7.3805385,-5.206346 parent: 2 - - uid: 8742 - components: - - type: Transform - pos: 0.2943418,9.643187 - parent: 2 - - uid: 8743 - components: - - type: Transform - pos: 0.30270588,15.612833 - parent: 2 - uid: 8800 components: - type: Transform @@ -71410,6 +77205,126 @@ entities: - type: Transform pos: 1.6402216,20.029284 parent: 2 + - uid: 15961 + components: + - type: Transform + pos: 3.501585,29.359072 + parent: 2 + - type: Paper + stampState: paper_stamp-centcom + stampedBy: + - stampedColor: '#006600FF' + stampedName: stamp-component-stamped-name-centcom + content: >- + ==ИНСТРУКЦИЯ ПО ИСПОЛЬЗОВАНИЮ ОБЩЕЙ КАМЕРЫ.== + + + =======Глава 1. Помещение заключенного в камеру.====== + + + 1. Завести заключенного в раздевалку. + + 2. Снять с него всю одежду и поместить ее в свободный шкафчик. + + 3. Надеть на него форму из шкафчика, в который вы сложили его форму. + + 4. Завести заключенного в буферную зону с двумя гермозатворами. + + 5. Поочередно открыть гермозатворы и впустить его в основную зону. + + + =======Глава 2. Выпуск заключенного из камеры.======== + + + 1. Позвать заключенного к гермозатвору. + + 2. Открыть первый гермозатвор и впустить заключенного в буферную зону. + + 3. Закрыть первый гермозатвор и открыть второй гермозатвор, если в буферной зоне отсутствуют посторонние лица. + + 4. Открыть шкафчик, который соответствует номеру заключенного. + + 5. Отдать вещи заключенного и поместить форму заключенного в шкафчик строго в соответствии с ее номером. + - uid: 15962 + components: + - type: Transform + pos: 3.5440702,29.432474 + parent: 2 + - type: Paper + stampState: paper_stamp-centcom + stampedBy: + - stampedColor: '#006600FF' + stampedName: stamp-component-stamped-name-centcom + content: >- + ==ИНСТРУКЦИЯ ПО ИСПОЛЬЗОВАНИЮ ОБЩЕЙ КАМЕРЫ.== + + + =======Глава 1. Помещение заключенного в камеру.====== + + + 1. Завести заключенного в раздевалку. + + 2. Снять с него всю одежду и поместить ее в свободный шкафчик. + + 3. Надеть на него форму из шкафчика, в который вы сложили его форму. + + 4. Завести заключенного в буферную зону с двумя гермозатворами. + + 5. Поочередно открыть гермозатворы и впустить его в основную зону. + + + =======Глава 2. Выпуск заключенного из камеры.======== + + + 1. Позвать заключенного к гермозатвору. + + 2. Открыть первый гермозатвор и впустить заключенного в буферную зону. + + 3. Закрыть первый гермозатвор и открыть второй гермозатвор, если в буферной зоне отсутствуют посторонние лица. + + 4. Открыть шкафчик, который соответствует номеру заключенного. + + 5. Отдать вещи заключенного и поместить форму заключенного в шкафчик строго в соответствии с ее номером. + - uid: 15963 + components: + - type: Transform + pos: 3.522973,29.37211 + parent: 2 + - type: Paper + stampState: paper_stamp-centcom + stampedBy: + - stampedColor: '#006600FF' + stampedName: stamp-component-stamped-name-centcom + content: >- + ==ИНСТРУКЦИЯ ПО ИСПОЛЬЗОВАНИЮ ОБЩЕЙ КАМЕРЫ.== + + + =======Глава 1. Помещение заключенного в камеру.====== + + + 1. Завести заключенного в раздевалку. + + 2. Снять с него всю одежду и поместить ее в свободный шкафчик. + + 3. Надеть на него форму из шкафчика, в который вы сложили его форму. + + 4. Завести заключенного в буферную зону с двумя гермозатворами. + + 5. Поочередно открыть гермозатворы и впустить его в основную зону. + + + =======Глава 2. Выпуск заключенного из камеры.======== + + + 1. Позвать заключенного к гермозатвору. + + 2. Открыть первый гермозатвор и впустить заключенного в буферную зону. + + 3. Закрыть первый гермозатвор и открыть второй гермозатвор, если в буферной зоне отсутствуют посторонние лица. + + 4. Открыть шкафчик, который соответствует номеру заключенного. + + 5. Отдать вещи заключенного и поместить форму заключенного в шкафчик строго в соответствии с ее номером. - proto: PaperBin10 entities: - uid: 5510 @@ -71519,16 +77434,6 @@ entities: - type: Transform pos: 4.6894355,-5.4769964 parent: 2 - - uid: 8744 - components: - - type: Transform - pos: 0.3999101,15.53666 - parent: 2 - - uid: 8745 - components: - - type: Transform - pos: 0.33886445,9.478624 - parent: 2 - uid: 8802 components: - type: Transform @@ -71611,6 +77516,13 @@ entities: - type: Transform pos: -41.300766,-7.3729534 parent: 2 +- proto: PlantBag + entities: + - uid: 5863 + components: + - type: Transform + pos: 12.773823,39.23071 + parent: 2 - proto: PlasmaCanister entities: - uid: 7173 @@ -71721,6 +77633,23 @@ entities: - type: Transform pos: -76.5,-5.5 parent: 2 +- proto: PlayerCardBag + entities: + - uid: 11562 + components: + - type: Transform + pos: 4.4948926,42.896683 + parent: 2 + - uid: 15309 + components: + - type: Transform + pos: 4.4102736,42.80098 + parent: 2 + - uid: 15629 + components: + - type: Transform + pos: 4.4817305,42.76635 + parent: 2 - proto: PlushieNar entities: - uid: 8458 @@ -71780,10 +77709,40 @@ entities: parent: 2 - proto: PortableFlasher entities: - - uid: 6719 + - uid: 540 components: - type: Transform - pos: 9.5,17.5 + pos: -0.5,9.5 + parent: 2 + - uid: 559 + components: + - type: Transform + pos: 0.5,32.5 + parent: 2 + - uid: 1004 + components: + - type: Transform + pos: 11.5,32.5 + parent: 2 + - uid: 4444 + components: + - type: Transform + pos: 7.5,29.5 + parent: 2 + - uid: 4446 + components: + - type: Transform + pos: 4.5,29.5 + parent: 2 + - uid: 8742 + components: + - type: Transform + pos: 0.5,9.5 + parent: 2 + - uid: 15234 + components: + - type: Transform + pos: 7.5,18.5 parent: 2 - proto: PortableGeneratorJrPacman entities: @@ -71852,6 +77811,13 @@ entities: - type: Transform pos: -54.5,-7.5 parent: 2 +- proto: PosterContrabandFreeSyndicateEncryptionKey + entities: + - uid: 15529 + components: + - type: Transform + pos: 13.5,-8.5 + parent: 2 - proto: PosterContrabandMoth entities: - uid: 6328 @@ -72035,6 +78001,11 @@ entities: - type: Transform pos: -56.5,-14.5 parent: 2 + - uid: 15662 + components: + - type: Transform + pos: 3.5,39.5 + parent: 2 - proto: PowerDrill entities: - uid: 14578 @@ -72233,34 +78204,11 @@ entities: rot: -1.5707963267948966 rad pos: -2.5,-4.5 parent: 2 - - uid: 11935 - components: - - type: Transform - rot: -1.5707963267948966 rad - pos: 10.5,17.5 - parent: 2 - - uid: 12557 - components: - - type: Transform - rot: -1.5707963267948966 rad - pos: 6.5,18.5 - parent: 2 - uid: 12562 components: - type: Transform pos: 11.5,27.5 parent: 2 - - uid: 12563 - components: - - type: Transform - pos: 2.5,31.5 - parent: 2 - - uid: 12564 - components: - - type: Transform - rot: -1.5707963267948966 rad - pos: 10.5,32.5 - parent: 2 - uid: 12567 components: - type: Transform @@ -72587,6 +78535,11 @@ entities: rot: 3.141592653589793 rad pos: -13.5,23.5 parent: 2 + - uid: 12709 + components: + - type: Transform + pos: 8.5,39.5 + parent: 2 - uid: 12710 components: - type: Transform @@ -72752,6 +78705,11 @@ entities: rot: 3.141592653589793 rad pos: -54.5,-6.5 parent: 2 + - uid: 14191 + components: + - type: Transform + pos: 3.5,39.5 + parent: 2 - uid: 14533 components: - type: Transform @@ -72808,6 +78766,47 @@ entities: rot: 1.5707963267948966 rad pos: -44.5,-40.5 parent: 2 + - uid: 14831 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -22.5,-28.5 + parent: 2 + - uid: 14977 + components: + - type: Transform + pos: -60.5,26.5 + parent: 2 + - uid: 15052 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 11.5,17.5 + parent: 2 + - uid: 15235 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 7.5,16.5 + parent: 2 + - uid: 15247 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -58.5,20.5 + parent: 2 + - uid: 15250 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -72.5,24.5 + parent: 2 + - uid: 15958 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 5.5,32.5 + parent: 2 - proto: PoweredlightExterior entities: - uid: 12755 @@ -72878,6 +78877,12 @@ entities: - type: Transform pos: -50.5,-40.5 parent: 2 + - uid: 175 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -67.5,34.5 + parent: 2 - uid: 1761 components: - type: Transform @@ -73025,6 +79030,12 @@ entities: rot: 1.5707963267948966 rad pos: -37.5,13.5 parent: 2 + - uid: 11565 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -67.5,24.5 + parent: 2 - uid: 12040 components: - type: Transform @@ -73060,12 +79071,6 @@ entities: rot: 1.5707963267948966 rad pos: 4.5,23.5 parent: 2 - - uid: 12560 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 3.5,33.5 - parent: 2 - uid: 12580 components: - type: Transform @@ -73657,6 +79662,78 @@ entities: rot: 1.5707963267948966 rad pos: -52.5,39.5 parent: 2 + - uid: 14862 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -77.5,34.5 + parent: 2 + - uid: 15050 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -74.5,28.5 + parent: 2 + - uid: 15068 + components: + - type: Transform + pos: -72.5,37.5 + parent: 2 + - uid: 15157 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -70.5,28.5 + parent: 2 + - uid: 15236 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -76.5,24.5 + parent: 2 + - uid: 15318 + components: + - type: Transform + pos: -55.5,18.5 + parent: 2 + - uid: 15621 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -65.5,24.5 + parent: 2 + - uid: 15925 + components: + - type: Transform + pos: 3.5,30.5 + parent: 2 + - uid: 15926 + components: + - type: Transform + pos: 8.5,30.5 + parent: 2 + - uid: 15928 + components: + - type: Transform + pos: 9.5,42.5 + parent: 2 + - uid: 15929 + components: + - type: Transform + pos: 2.5,42.5 + parent: 2 + - uid: 15956 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 0.5,32.5 + parent: 2 + - uid: 15957 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 11.5,32.5 + parent: 2 - proto: Protolathe entities: - uid: 6314 @@ -73678,6 +79755,18 @@ entities: parent: 2 - proto: Rack entities: + - uid: 610 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 7.5,32.5 + parent: 2 + - uid: 620 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 7.5,33.5 + parent: 2 - uid: 904 components: - type: Transform @@ -73779,6 +79868,11 @@ entities: - type: Transform pos: 16.5,15.5 parent: 2 + - uid: 8824 + components: + - type: Transform + pos: 3.5,29.5 + parent: 2 - uid: 9409 components: - type: Transform @@ -73834,16 +79928,6 @@ entities: - type: Transform pos: 1.5,-18.5 parent: 2 - - uid: 9481 - components: - - type: Transform - pos: 15.5,18.5 - parent: 2 - - uid: 9563 - components: - - type: Transform - pos: 12.5,-8.5 - parent: 2 - uid: 9569 components: - type: Transform @@ -73907,6 +79991,11 @@ entities: rot: 1.5707963267948966 rad pos: -35.5,29.5 parent: 2 + - uid: 12359 + components: + - type: Transform + pos: 8.5,29.5 + parent: 2 - uid: 13178 components: - type: Transform @@ -73945,6 +80034,27 @@ entities: - type: Transform pos: -47.5,35.5 parent: 2 + - uid: 14711 + components: + - type: Transform + pos: 8.5,-11.5 + parent: 2 + - uid: 15134 + components: + - type: Transform + pos: 16.5,18.5 + parent: 2 + - uid: 15324 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -54.5,18.5 + parent: 2 + - uid: 15659 + components: + - type: Transform + pos: 4.5,40.5 + parent: 2 - proto: RadarConsoleCircuitboard entities: - uid: 14460 @@ -73952,6 +80062,28 @@ entities: - type: Transform pos: -52.436752,4.296235 parent: 2 +- proto: RadiationCollector + entities: + - uid: 14916 + components: + - type: Transform + pos: -70.5,32.5 + parent: 2 + - uid: 14917 + components: + - type: Transform + pos: -70.5,34.5 + parent: 2 + - uid: 14918 + components: + - type: Transform + pos: -74.5,34.5 + parent: 2 + - uid: 14919 + components: + - type: Transform + pos: -74.5,32.5 + parent: 2 - proto: RadioHandheld entities: - uid: 5554 @@ -73979,28 +80111,6 @@ entities: rot: 1.5707963267948966 rad pos: -10.5,-25.5 parent: 2 - - uid: 5933 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 8.5,29.5 - parent: 2 - - uid: 5934 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 8.5,30.5 - parent: 2 - - uid: 5935 - components: - - type: Transform - pos: 9.5,31.5 - parent: 2 - - uid: 5936 - components: - - type: Transform - pos: 10.5,31.5 - parent: 2 - uid: 6725 components: - type: Transform @@ -74188,12 +80298,6 @@ entities: rot: 3.141592653589793 rad pos: -18.5,23.5 parent: 2 - - uid: 5937 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 8.5,31.5 - parent: 2 - uid: 7077 components: - type: Transform @@ -74234,13 +80338,6 @@ entities: - type: Transform pos: -60.5,-11.5 parent: 2 -- proto: RandomArcade - entities: - - uid: 5851 - components: - - type: Transform - pos: 3.5,31.5 - parent: 2 - proto: RandomArtifactSpawner entities: - uid: 13517 @@ -74392,12 +80489,6 @@ entities: rot: 3.141592653589793 rad pos: -29.5,12.5 parent: 2 - - uid: 14092 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: -21.5,-32.5 - parent: 2 - uid: 14093 components: - type: Transform @@ -74605,31 +80696,38 @@ entities: - type: Transform pos: -57.5,29.5 parent: 2 -- proto: RandomPosterContraband - entities: - - uid: 2065 + - uid: 15996 components: - type: Transform - rot: 3.141592653589793 rad - pos: 12.5,15.5 + pos: 3.5,31.5 parent: 2 + - uid: 15997 + components: + - type: Transform + pos: 8.5,40.5 + parent: 2 + - uid: 15998 + components: + - type: Transform + pos: 3.5,40.5 + parent: 2 + - uid: 15999 + components: + - type: Transform + pos: 12.5,41.5 + parent: 2 + - uid: 16000 + components: + - type: Transform + pos: 4.5,43.5 + parent: 2 +- proto: RandomPosterContraband + entities: - uid: 9607 components: - type: Transform pos: -48.5,11.5 parent: 2 - - uid: 14074 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 3.5,35.5 - parent: 2 - - uid: 14136 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 14.5,17.5 - parent: 2 - uid: 14137 components: - type: Transform @@ -74761,6 +80859,11 @@ entities: - type: Transform pos: -49.5,-43.5 parent: 2 + - uid: 15033 + components: + - type: Transform + pos: 15.5,16.5 + parent: 2 - proto: RandomPosterLegit entities: - uid: 252 @@ -74878,18 +80981,6 @@ entities: rot: 3.141592653589793 rad pos: 8.5,5.5 parent: 2 - - uid: 14075 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 11.5,32.5 - parent: 2 - - uid: 14076 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 3.5,32.5 - parent: 2 - uid: 14077 components: - type: Transform @@ -75194,10 +81285,10 @@ entities: parent: 2 - proto: RandomToolbox entities: - - uid: 12555 + - uid: 15137 components: - type: Transform - pos: 15.5,18.5 + pos: 16.5,18.5 parent: 2 - proto: RandomVomit entities: @@ -75288,6 +81379,32 @@ entities: - type: Physics canCollide: False - type: InsideEntityStorage +- proto: ReagentContainerCornmeal + entities: + - uid: 2943 + components: + - type: Transform + pos: -17.196201,-15.211575 + parent: 2 +- proto: ReagentContainerFlour + entities: + - uid: 998 + components: + - type: Transform + pos: -0.60373616,36.540253 + parent: 2 + - uid: 6705 + components: + - type: Transform + pos: -17.235981,-15.398273 + parent: 2 + - uid: 15641 + components: + - type: Transform + parent: 15640 + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: ReagentContainerMayo entities: - uid: 14181 @@ -75298,6 +81415,13 @@ entities: - type: Transform pos: -31.624126,2.4380324 parent: 2 +- proto: ReagentContainerSugar + entities: + - uid: 1003 + components: + - type: Transform + pos: -0.37317306,36.683716 + parent: 2 - proto: Recycler entities: - uid: 12866 @@ -75394,6 +81518,16 @@ entities: - type: Transform pos: -42.5,24.5 parent: 2 + - uid: 15144 + components: + - type: Transform + pos: -73.5,27.5 + parent: 2 + - uid: 15145 + components: + - type: Transform + pos: -71.5,27.5 + parent: 2 - proto: ReinforcedWindow entities: - uid: 108 @@ -75475,11 +81609,6 @@ entities: - type: Transform pos: -1.5,13.5 parent: 2 - - uid: 200 - components: - - type: Transform - pos: -1.5,9.5 - parent: 2 - uid: 305 components: - type: Transform @@ -75520,11 +81649,6 @@ entities: - type: Transform pos: -43.5,-2.5 parent: 2 - - uid: 343 - components: - - type: Transform - pos: -1.5,10.5 - parent: 2 - uid: 347 components: - type: Transform @@ -75571,26 +81695,11 @@ entities: - type: Transform pos: 7.5,2.5 parent: 2 - - uid: 412 - components: - - type: Transform - pos: 1.5,9.5 - parent: 2 - uid: 419 components: - type: Transform pos: 6.5,12.5 parent: 2 - - uid: 422 - components: - - type: Transform - pos: 2.5,16.5 - parent: 2 - - uid: 423 - components: - - type: Transform - pos: 3.5,16.5 - parent: 2 - uid: 429 components: - type: Transform @@ -75837,26 +81946,11 @@ entities: - type: Transform pos: 7.5,-38.5 parent: 2 - - uid: 535 - components: - - type: Transform - pos: 1.5,10.5 - parent: 2 - uid: 538 components: - type: Transform pos: 6.5,11.5 parent: 2 - - uid: 540 - components: - - type: Transform - pos: 1.5,14.5 - parent: 2 - - uid: 541 - components: - - type: Transform - pos: 1.5,15.5 - parent: 2 - uid: 577 components: - type: Transform @@ -75897,11 +81991,23 @@ entities: - type: Transform pos: -64.5,2.5 parent: 2 + - uid: 615 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 8.5,35.5 + parent: 2 - uid: 618 components: - type: Transform pos: -64.5,3.5 parent: 2 + - uid: 619 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 8.5,34.5 + parent: 2 - uid: 623 components: - type: Transform @@ -76296,7 +82402,7 @@ entities: components: - type: Transform rot: 3.141592653589793 rad - pos: 7.5,33.5 + pos: 7.5,31.5 parent: 2 - uid: 954 components: @@ -76308,7 +82414,7 @@ entities: components: - type: Transform rot: 3.141592653589793 rad - pos: 0.5,31.5 + pos: 4.5,31.5 parent: 2 - uid: 957 components: @@ -76322,12 +82428,6 @@ entities: rot: 3.141592653589793 rad pos: 4.5,25.5 parent: 2 - - uid: 960 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 0.5,30.5 - parent: 2 - uid: 961 components: - type: Transform @@ -76340,6 +82440,12 @@ entities: rot: 3.141592653589793 rad pos: 39.5,12.5 parent: 2 + - uid: 963 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 8.5,32.5 + parent: 2 - uid: 964 components: - type: Transform @@ -76350,7 +82456,7 @@ entities: components: - type: Transform rot: 3.141592653589793 rad - pos: 0.5,29.5 + pos: 3.5,32.5 parent: 2 - uid: 966 components: @@ -76424,36 +82530,18 @@ entities: rot: 3.141592653589793 rad pos: 33.5,9.5 parent: 2 - - uid: 994 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 11.5,29.5 - parent: 2 - uid: 996 components: - type: Transform rot: 3.141592653589793 rad pos: 33.5,10.5 parent: 2 - - uid: 999 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 11.5,30.5 - parent: 2 - uid: 1001 components: - type: Transform rot: 3.141592653589793 rad pos: 33.5,11.5 parent: 2 - - uid: 1004 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 11.5,31.5 - parent: 2 - uid: 1005 components: - type: Transform @@ -76478,24 +82566,12 @@ entities: rot: 3.141592653589793 rad pos: 23.5,8.5 parent: 2 - - uid: 1013 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 9.5,33.5 - parent: 2 - uid: 1015 components: - type: Transform rot: 3.141592653589793 rad pos: 23.5,9.5 parent: 2 - - uid: 1018 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 8.5,33.5 - parent: 2 - uid: 1022 components: - type: Transform @@ -77007,11 +83083,6 @@ entities: - type: Transform pos: -45.5,-8.5 parent: 2 - - uid: 1995 - components: - - type: Transform - pos: -1.5,11.5 - parent: 2 - uid: 1997 components: - type: Transform @@ -77359,6 +83430,18 @@ entities: - type: Transform pos: 36.5,8.5 parent: 2 + - uid: 5855 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 7.5,36.5 + parent: 2 + - uid: 5902 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 5.5,31.5 + parent: 2 - uid: 6147 components: - type: Transform @@ -77428,6 +83511,12 @@ entities: - type: Transform pos: 36.5,6.5 parent: 2 + - uid: 7801 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 4.5,36.5 + parent: 2 - uid: 8139 components: - type: Transform @@ -77484,6 +83573,41 @@ entities: rot: 1.5707963267948966 rad pos: -85.5,-34.5 parent: 2 + - uid: 11569 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 3.5,35.5 + parent: 2 + - uid: 11570 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 3.5,34.5 + parent: 2 + - uid: 11571 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 6.5,36.5 + parent: 2 + - uid: 11573 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 5.5,36.5 + parent: 2 + - uid: 11574 + components: + - type: Transform + pos: 2.5,13.5 + parent: 2 + - uid: 11575 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 9.5,33.5 + parent: 2 - uid: 11901 components: - type: Transform @@ -77547,11 +83671,60 @@ entities: - type: Transform pos: 2.5,3.5 parent: 2 + - uid: 13576 + components: + - type: Transform + pos: 2.5,33.5 + parent: 2 - uid: 14430 components: - type: Transform pos: -54.5,1.5 parent: 2 + - uid: 14863 + components: + - type: Transform + pos: -73.5,34.5 + parent: 2 + - uid: 14864 + components: + - type: Transform + pos: -73.5,33.5 + parent: 2 + - uid: 14865 + components: + - type: Transform + pos: -73.5,32.5 + parent: 2 + - uid: 14867 + components: + - type: Transform + pos: -71.5,33.5 + parent: 2 + - uid: 14868 + components: + - type: Transform + pos: -71.5,32.5 + parent: 2 + - uid: 15036 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -71.5,34.5 + parent: 2 +- proto: ReinforcedWindowDiagonal + entities: + - uid: 5840 + components: + - type: Transform + pos: 3.5,36.5 + parent: 2 + - uid: 5841 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 8.5,36.5 + parent: 2 - proto: RemoteSignaller entities: - uid: 8845 @@ -77588,6 +83761,116 @@ entities: - type: Transform pos: -45.505722,-25.40746 parent: 2 +- proto: RiotBulletShield + entities: + - uid: 15976 + components: + - type: Transform + pos: 11.288734,17.5587 + parent: 2 + - type: Blocking + blockingToggleActionEntity: 15977 + - type: ActionsContainer + - type: ContainerContainer + containers: + actions: !type:Container + ents: + - 15977 + - uid: 15980 + components: + - type: Transform + pos: 11.659305,17.55867 + parent: 2 + - type: Blocking + blockingToggleActionEntity: 15981 + - type: ActionsContainer + - type: ContainerContainer + containers: + actions: !type:Container + ents: + - 15981 +- proto: RiotLaserShield + entities: + - uid: 15974 + components: + - type: Transform + pos: 11.318964,18.154612 + parent: 2 + - type: Blocking + blockingToggleActionEntity: 15975 + - type: ActionsContainer + - type: ContainerContainer + containers: + actions: !type:Container + ents: + - 15975 + - uid: 15978 + components: + - type: Transform + pos: 11.667342,18.207937 + parent: 2 + - type: Blocking + blockingToggleActionEntity: 15979 + - type: ActionsContainer + - type: ContainerContainer + containers: + actions: !type:Container + ents: + - 15979 +- proto: RiotShield + entities: + - uid: 556 + components: + - type: Transform + pos: 7.7036066,33.385563 + parent: 2 + - type: Blocking + blockingToggleActionEntity: 557 + - type: ActionsContainer + - type: ContainerContainer + containers: + actions: !type:Container + ents: + - 557 + - uid: 992 + components: + - type: Transform + pos: 7.395007,33.389923 + parent: 2 + - type: Blocking + blockingToggleActionEntity: 993 + - type: ActionsContainer + - type: ContainerContainer + containers: + actions: !type:Container + ents: + - 993 + - uid: 15986 + components: + - type: Transform + pos: 11.327087,17.967003 + parent: 2 + - type: Blocking + blockingToggleActionEntity: 15987 + - type: ActionsContainer + - type: ContainerContainer + containers: + actions: !type:Container + ents: + - 15987 + - uid: 15990 + components: + - type: Transform + pos: 11.6252165,17.977272 + parent: 2 + - type: Blocking + blockingToggleActionEntity: 15991 + - type: ActionsContainer + - type: ContainerContainer + containers: + actions: !type:Container + ents: + - 15991 - proto: RockGuitarInstrument entities: - uid: 3328 @@ -77612,6 +83895,13 @@ entities: - type: Transform pos: -35.461044,-13.332869 parent: 2 +- proto: RollingPin + entities: + - uid: 4450 + components: + - type: Transform + pos: -0.47923994,38.0213 + parent: 2 - proto: RubberStampApproved entities: - uid: 2858 @@ -77687,13 +83977,6 @@ entities: - type: Transform pos: 8.540806,-18.325834 parent: 2 -- proto: SbHampter - entities: - - uid: 5442 - components: - - type: Transform - pos: 8.014546,34.532085 - parent: 2 - proto: ScalpelShiv entities: - uid: 14390 @@ -77792,16 +84075,16 @@ entities: parent: 2 - proto: SeedExtractor entities: - - uid: 5848 - components: - - type: Transform - pos: 10.5,32.5 - parent: 2 - uid: 6733 components: - type: Transform pos: -17.5,-3.5 parent: 2 + - uid: 11561 + components: + - type: Transform + pos: 8.5,39.5 + parent: 2 - proto: ShardGlass entities: - uid: 505 @@ -77974,6 +84257,11 @@ entities: - type: Transform pos: -39.56723,22.28059 parent: 2 + - uid: 15167 + components: + - type: Transform + pos: -71.63785,24.606619 + parent: 2 - proto: ShellShotgunImprovised entities: - uid: 14773 @@ -78006,6 +84294,14 @@ entities: parent: 2 - proto: ShuttersNormalOpen entities: + - uid: 596 + components: + - type: Transform + pos: 2.5,13.5 + parent: 2 + - type: DeviceLinkSink + links: + - 12706 - uid: 5785 components: - type: Transform @@ -78022,54 +84318,6 @@ entities: - type: DeviceLinkSink links: - 5524 - - uid: 5787 - components: - - type: Transform - pos: -1.5,13.5 - parent: 2 - - type: DeviceLinkSink - links: - - 5806 - - uid: 5788 - components: - - type: Transform - pos: -1.5,14.5 - parent: 2 - - type: DeviceLinkSink - links: - - 5806 - - uid: 5789 - components: - - type: Transform - pos: -1.5,15.5 - parent: 2 - - type: DeviceLinkSink - links: - - 5806 - - uid: 5790 - components: - - type: Transform - pos: -1.5,11.5 - parent: 2 - - type: DeviceLinkSink - links: - - 5806 - - uid: 5791 - components: - - type: Transform - pos: -1.5,10.5 - parent: 2 - - type: DeviceLinkSink - links: - - 5806 - - uid: 5792 - components: - - type: Transform - pos: -1.5,9.5 - parent: 2 - - type: DeviceLinkSink - links: - - 5806 - uid: 5793 components: - type: Transform @@ -78134,22 +84382,6 @@ entities: - type: DeviceLinkSink links: - 5524 - - uid: 5801 - components: - - type: Transform - pos: 2.5,16.5 - parent: 2 - - type: DeviceLinkSink - links: - - 5805 - - uid: 5802 - components: - - type: Transform - pos: 3.5,16.5 - parent: 2 - - type: DeviceLinkSink - links: - - 5805 - uid: 5803 components: - type: Transform @@ -78396,6 +84628,30 @@ entities: - type: DeviceLinkSink links: - 724 + - uid: 15930 + components: + - type: Transform + pos: -1.5,14.5 + parent: 2 + - type: DeviceLinkSink + links: + - 12706 + - uid: 15931 + components: + - type: Transform + pos: -1.5,15.5 + parent: 2 + - type: DeviceLinkSink + links: + - 12706 + - uid: 15943 + components: + - type: Transform + pos: -1.5,13.5 + parent: 2 + - type: DeviceLinkSink + links: + - 12706 - proto: ShuttleConsoleCircuitboard entities: - uid: 14459 @@ -78465,30 +84721,6 @@ entities: - Pressed: Toggle 5804: - Pressed: Toggle - 5802: - - Pressed: Toggle - 5801: - - Pressed: Toggle - - uid: 5806 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 1.5,12.5 - parent: 2 - - type: DeviceLinkSource - linkedPorts: - 5792: - - Pressed: Toggle - 5791: - - Pressed: Toggle - 5790: - - Pressed: Toggle - 5787: - - Pressed: Toggle - 5788: - - Pressed: Toggle - 5789: - - Pressed: Toggle - uid: 5807 components: - type: Transform @@ -78500,6 +84732,18 @@ entities: - Pressed: Toggle 5794: - Pressed: Toggle + - uid: 5867 + components: + - type: MetaData + name: Буферная зона - гардероб + - type: Transform + rot: 3.141592653589793 rad + pos: 5.4852057,31.58214 + parent: 2 + - type: DeviceLinkSource + linkedPorts: + 5860: + - Pressed: Toggle - uid: 5968 components: - type: Transform @@ -78693,6 +84937,18 @@ entities: linkedPorts: 1452: - Pressed: Toggle + - uid: 11641 + components: + - type: MetaData + name: Буферная зона - тюрьма + - type: Transform + rot: 3.141592653589793 rad + pos: 5.1870832,31.571426 + parent: 2 + - type: DeviceLinkSource + linkedPorts: + 5866: + - Pressed: Toggle - uid: 12474 components: - type: Transform @@ -78796,6 +85052,21 @@ entities: - Pressed: Toggle 13651: - Pressed: Toggle + - uid: 12706 + components: + - type: Transform + pos: 1.5,16.5 + parent: 2 + - type: DeviceLinkSource + linkedPorts: + 15931: + - Pressed: Toggle + 15930: + - Pressed: Toggle + 15943: + - Pressed: Toggle + 596: + - Pressed: Toggle - uid: 12867 components: - type: Transform @@ -78826,6 +85097,45 @@ entities: linkedPorts: 7153: - Pressed: Toggle + - uid: 15136 + components: + - type: Transform + pos: -71.5,31.5 + parent: 2 + - type: DeviceLinkSource + linkedPorts: + 15164: + - Pressed: Toggle + 15158: + - Pressed: Toggle + 15159: + - Pressed: Toggle + 15160: + - Pressed: Toggle + 15163: + - Pressed: Toggle + 15162: + - Pressed: Toggle + 15161: + - Pressed: Toggle + 15156: + - Pressed: Toggle + 15232: + - Pressed: Toggle + - uid: 15197 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -74.5,27.5 + parent: 2 + - type: DeviceLinkSource + linkedPorts: + 15193: + - Pressed: Toggle + 15195: + - Pressed: Toggle + 15194: + - Pressed: Toggle - proto: SignalButtonWindows entities: - uid: 13356 @@ -78888,11 +85198,10 @@ entities: parent: 2 - proto: SignArmory entities: - - uid: 6935 + - uid: 15229 components: - type: Transform - rot: 1.5707963267948966 rad - pos: 7.5,18.5 + pos: 8.5,18.5 parent: 2 - proto: SignAtmos entities: @@ -79011,6 +85320,11 @@ entities: - type: Transform pos: -32.5,21.5 parent: 2 + - uid: 15325 + components: + - type: Transform + pos: -62.5,24.5 + parent: 2 - proto: SignDirectionalBar entities: - uid: 1500 @@ -79091,18 +85405,18 @@ entities: rot: -1.5707963267948966 rad pos: -28.48877,1.6895766 parent: 2 - - uid: 12237 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: -21.51046,-32.514336 - parent: 2 - uid: 13064 components: - type: Transform rot: -1.5707963267948966 rad pos: -4.488947,2.1464903 parent: 2 + - uid: 14830 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -21.533339,-32.490707 + parent: 2 - proto: SignDirectionalFood entities: - uid: 14785 @@ -79209,11 +85523,17 @@ entities: rot: 1.5707963267948966 rad pos: -1.5,16.5 parent: 2 - - uid: 13576 + - uid: 15945 components: - type: Transform - rot: 1.5707963267948966 rad - pos: -1.5,8.5 + pos: -1.5,12.5 + parent: 2 +- proto: SignEngine + entities: + - uid: 15542 + components: + - type: Transform + pos: -54.5,21.5 parent: 2 - proto: SignEngineering entities: @@ -79289,6 +85609,13 @@ entities: rot: 1.5707963267948966 rad pos: -22.5,-6.5 parent: 2 +- proto: SignInterrogation + entities: + - uid: 15944 + components: + - type: Transform + pos: 2.5,15.5 + parent: 2 - proto: SignJanitor entities: - uid: 8741 @@ -79363,11 +85690,10 @@ entities: parent: 2 - proto: SignPrison entities: - - uid: 12395 + - uid: 15972 components: - type: Transform - rot: 1.5707963267948966 rad - pos: -1.5,12.5 + pos: 7.5,24.5 parent: 2 - proto: SignPsychology entities: @@ -79380,6 +85706,55 @@ entities: rot: -1.5707963267948966 rad pos: -40.5,-8.5 parent: 2 +- proto: SignRedFour + entities: + - uid: 953 + components: + - type: Transform + pos: 11.438797,29.218342 + parent: 2 + - uid: 15927 + components: + - type: Transform + pos: 11.5,34.5 + parent: 2 +- proto: SignRedOne + entities: + - uid: 2542 + components: + - type: Transform + pos: 0.43953943,30.233011 + parent: 2 + - uid: 15939 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 0.5,35.5 + parent: 2 +- proto: SignRedThree + entities: + - uid: 601 + components: + - type: Transform + pos: 11.455588,30.24144 + parent: 2 + - uid: 12690 + components: + - type: Transform + pos: 11.5,35.5 + parent: 2 +- proto: SignRedTwo + entities: + - uid: 968 + components: + - type: Transform + pos: 0.4586916,29.176273 + parent: 2 + - uid: 13559 + components: + - type: Transform + pos: 0.5,34.5 + parent: 2 - proto: SignRND entities: - uid: 12384 @@ -79416,11 +85791,10 @@ entities: parent: 2 - proto: SignSecureMedRed entities: - - uid: 12398 + - uid: 15230 components: - type: Transform - rot: -1.5707963267948966 rad - pos: 7.5,16.5 + pos: 8.5,16.5 parent: 2 - proto: SignShipDock entities: @@ -79497,22 +85871,11 @@ entities: parent: 2 - proto: Sink entities: - - uid: 4789 + - uid: 8148 components: - type: Transform - pos: 3.5,34.5 - parent: 2 - - uid: 12700 - components: - - type: Transform - rot: -1.5707963267948966 rad - pos: 0.5,14.5 - parent: 2 - - uid: 12701 - components: - - type: Transform - rot: -1.5707963267948966 rad - pos: 0.5,10.5 + rot: 3.141592653589793 rad + pos: -14.5,-15.5 parent: 2 - proto: SinkStemlessWater entities: @@ -79521,6 +85884,11 @@ entities: - type: Transform pos: -39.5,-51.5 parent: 2 + - uid: 11540 + components: + - type: Transform + pos: 1.5,42.5 + parent: 2 - uid: 12892 components: - type: Transform @@ -79533,6 +85901,16 @@ entities: rot: -1.5707963267948966 rad pos: -41.5,-4.5 parent: 2 + - uid: 14295 + components: + - type: Transform + pos: 9.5,39.5 + parent: 2 + - uid: 14855 + components: + - type: Transform + pos: 10.5,42.5 + parent: 2 - proto: SinkWide entities: - uid: 6701 @@ -79613,6 +85991,11 @@ entities: - type: Transform pos: -33.5,27.5 parent: 2 + - uid: 15057 + components: + - type: Transform + pos: -68.5,28.5 + parent: 2 - proto: SmokingPipe entities: - uid: 5842 @@ -79899,13 +86282,6 @@ entities: - 14815 - 14816 - 14817 -- proto: Soap - entities: - - uid: 9902 - components: - - type: Transform - pos: 4.5875382,34.64797 - parent: 2 - proto: SoapOmega entities: - uid: 6134 @@ -81875,6 +88251,13 @@ entities: - type: Transform pos: 0.56126785,-23.289867 parent: 2 +- proto: SpaceTickSpawner + entities: + - uid: 15548 + components: + - type: Transform + pos: 14.5,-8.5 + parent: 2 - proto: SpaceVillainArcade entities: - uid: 66 @@ -81884,6 +88267,14 @@ entities: parent: 2 - type: SpamEmitSound enabled: False + - uid: 414 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 9.5,35.5 + parent: 2 + - type: SpamEmitSound + enabled: False - uid: 8119 components: - type: Transform @@ -81917,14 +88308,6 @@ entities: parent: 2 - type: SpamEmitSound enabled: False - - uid: 8733 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: -0.5,11.5 - parent: 2 - - type: SpamEmitSound - enabled: False - proto: SpawnMobBandito entities: - uid: 14213 @@ -81932,6 +88315,13 @@ entities: - type: Transform pos: -10.5,-41.5 parent: 2 +- proto: SpawnMobBear + entities: + - uid: 11884 + components: + - type: Transform + pos: -61.5,33.5 + parent: 2 - proto: SpawnMobButterfly entities: - uid: 2916 @@ -82002,6 +88392,14 @@ entities: - type: Transform pos: -16.5,9.5 parent: 2 +- proto: SpawnMobGoat + entities: + - uid: 14836 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -27.5,4.5 + parent: 2 - proto: SpawnMobMcGriff entities: - uid: 13490 @@ -82016,6 +88414,13 @@ entities: - type: Transform pos: -30.5,-11.5 parent: 2 +- proto: SpawnMobMonkeyPunpun + entities: + - uid: 14835 + components: + - type: Transform + pos: -7.5,-6.5 + parent: 2 - proto: SpawnMobPossumMorty entities: - uid: 13530 @@ -82735,16 +89140,16 @@ entities: - type: Transform pos: -12.5,-13.5 parent: 2 - - uid: 13484 - components: - - type: Transform - pos: -16.5,-13.5 - parent: 2 - uid: 13485 components: - type: Transform pos: -9.5,-5.5 parent: 2 + - uid: 16008 + components: + - type: Transform + pos: -15.5,-14.5 + parent: 2 - proto: SpawnPointStationEngineer entities: - uid: 13451 @@ -82811,13 +89216,6 @@ entities: - type: Transform pos: 4.5,10.5 parent: 2 -- proto: SpoonPlastic - entities: - - uid: 5854 - components: - - type: Transform - pos: 7.3637595,32.45407 - parent: 2 - proto: SprayBottleSpaceCleaner entities: - uid: 9075 @@ -83027,6 +89425,20 @@ entities: parent: 2 - type: PolymorphableCanister currentPrototype: StorageCanister + - uid: 15090 + components: + - type: Transform + pos: -76.5,25.5 + parent: 2 + - type: PolymorphableCanister + currentPrototype: StorageCanister + - uid: 15127 + components: + - type: Transform + pos: -76.5,24.5 + parent: 2 + - type: PolymorphableCanister + currentPrototype: StorageCanister - proto: SubstationBasic entities: - uid: 2592 @@ -83074,6 +89486,11 @@ entities: - type: Transform pos: -37.5,15.5 parent: 2 + - uid: 15076 + components: + - type: Transform + pos: -67.5,28.5 + parent: 2 - proto: SubstationBasicEmpty entities: - uid: 2595 @@ -83116,6 +89533,13 @@ entities: ents: - 7115 - 7121 +- proto: supermatter + entities: + - uid: 15183 + components: + - type: Transform + pos: -72.5,33.5 + parent: 2 - proto: SurveillanceCameraCommand entities: - uid: 12390 @@ -83299,6 +89723,21 @@ entities: parent: 2 - type: SurveillanceCamera id: Атмос - 3 + - uid: 15222 + components: + - type: Transform + pos: -73.5,28.5 + parent: 2 + - type: SurveillanceCamera + id: Суперматерия - 1 + - uid: 15545 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -72.5,37.5 + parent: 2 + - type: SurveillanceCamera + id: Суперматерия - 2 - proto: SurveillanceCameraGeneral entities: - uid: 5763 @@ -83470,6 +89909,13 @@ entities: parent: 2 - type: SurveillanceCamera id: Аркады + - uid: 15971 + components: + - type: Transform + pos: 7.5,29.5 + parent: 2 + - type: SurveillanceCamera + id: Раздевалка общей камеры - proto: SurveillanceCameraMedical entities: - uid: 5029 @@ -83669,21 +90115,6 @@ entities: parent: 2 - type: SurveillanceCamera id: Бриг - - uid: 12449 - components: - - type: Transform - pos: 7.5,29.5 - parent: 2 - - type: SurveillanceCamera - id: Перма-бриг - - uid: 12450 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 10.5,17.5 - parent: 2 - - type: SurveillanceCamera - id: Оружейная - uid: 12456 components: - type: Transform @@ -83706,6 +90137,20 @@ entities: parent: 2 - type: SurveillanceCamera id: Кабинет смотрителя + - uid: 15054 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 11.5,17.5 + parent: 2 + - uid: 15970 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 6.5,42.5 + parent: 2 + - type: SurveillanceCamera + id: Общая камера - proto: SurveillanceCameraService entities: - uid: 12452 @@ -83865,14 +90310,6 @@ entities: rot: -1.5707963267948966 rad pos: 11.5,-4.5 parent: 2 -- proto: SurvivalKnife - entities: - - uid: 5518 - components: - - type: Transform - rot: -1.5707963267948966 rad - pos: -57.20554,20.941332 - parent: 2 - proto: SynthesizerInstrument entities: - uid: 8988 @@ -83896,6 +90333,11 @@ entities: parent: 2 - proto: Table entities: + - uid: 999 + components: + - type: Transform + pos: 4.5,42.5 + parent: 2 - uid: 1203 components: - type: Transform @@ -83918,26 +90360,16 @@ entities: rot: 1.5707963267948966 rad pos: 3.5,-32.5 parent: 2 - - uid: 5832 + - uid: 2533 components: - type: Transform - pos: 7.5,32.5 + pos: -0.5,37.5 parent: 2 - - uid: 5833 - components: - - type: Transform - pos: 8.5,32.5 - parent: 2 - - uid: 5835 + - uid: 5442 components: - type: Transform rot: 1.5707963267948966 rad - pos: 5.5,30.5 - parent: 2 - - uid: 5849 - components: - - type: Transform - pos: 2.5,31.5 + pos: 6.5,42.5 parent: 2 - uid: 6362 components: @@ -84071,11 +90503,51 @@ entities: - type: Transform pos: -40.5,-52.5 parent: 2 + - uid: 11517 + components: + - type: Transform + pos: 4.5,41.5 + parent: 2 + - uid: 11579 + components: + - type: Transform + pos: 0.5,36.5 + parent: 2 + - uid: 11581 + components: + - type: Transform + pos: -0.5,36.5 + parent: 2 + - uid: 11599 + components: + - type: Transform + pos: 12.5,38.5 + parent: 2 + - uid: 11602 + components: + - type: Transform + pos: 12.5,39.5 + parent: 2 - uid: 11934 components: - type: Transform pos: -61.5,-14.5 parent: 2 + - uid: 15285 + components: + - type: Transform + pos: -0.5,38.5 + parent: 2 + - uid: 15627 + components: + - type: Transform + pos: 7.5,42.5 + parent: 2 + - uid: 15661 + components: + - type: Transform + pos: 3.5,39.5 + parent: 2 - proto: TableCarpet entities: - uid: 1850 @@ -84320,6 +90792,16 @@ entities: - type: Transform pos: -13.5,-12.5 parent: 2 + - uid: 422 + components: + - type: Transform + pos: 0.5,14.5 + parent: 2 + - uid: 863 + components: + - type: Transform + pos: -16.5,-12.5 + parent: 2 - uid: 868 components: - type: Transform @@ -84347,6 +90829,11 @@ entities: rot: 3.141592653589793 rad pos: -22.5,-4.5 parent: 2 + - uid: 939 + components: + - type: Transform + pos: -71.5,24.5 + parent: 2 - uid: 1106 components: - type: Transform @@ -84466,6 +90953,28 @@ entities: - type: Transform pos: -28.5,-18.5 parent: 2 + - uid: 5802 + components: + - type: Transform + pos: 11.5,18.5 + parent: 2 + - uid: 5806 + components: + - type: Transform + pos: 11.5,16.5 + parent: 2 + - uid: 5833 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 7.5,34.5 + parent: 2 + - uid: 5864 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 7.5,35.5 + parent: 2 - uid: 5890 components: - type: Transform @@ -84556,16 +91065,6 @@ entities: - type: Transform pos: -46.5,-4.5 parent: 2 - - uid: 8452 - components: - - type: Transform - pos: 0.5,9.5 - parent: 2 - - uid: 8453 - components: - - type: Transform - pos: 0.5,15.5 - parent: 2 - uid: 9533 components: - type: Transform @@ -84720,6 +91219,34 @@ entities: rot: 1.5707963267948966 rad pos: -39.5,21.5 parent: 2 + - uid: 15141 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -73.5,24.5 + parent: 2 + - uid: 15165 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -72.5,24.5 + parent: 2 + - uid: 15932 + components: + - type: Transform + pos: 0.5,15.5 + parent: 2 + - uid: 15951 + components: + - type: Transform + pos: 11.5,17.5 + parent: 2 + - uid: 16005 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -16.5,-13.5 + parent: 2 - proto: TableReinforcedGlass entities: - uid: 1964 @@ -85273,31 +91800,36 @@ entities: - type: Transform pos: -9.5,-15.5 parent: 2 -- proto: TegCenter +- proto: TearGasGrenade entities: - - uid: 14708 + - uid: 15723 components: - type: Transform - rot: 1.5707963267948966 rad - pos: -53.5,30.5 - parent: 2 -- proto: TegCirculator - entities: - - uid: 14711 + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15724 components: - type: Transform - pos: -52.5,30.5 - parent: 2 - - type: PointLight - color: '#FF3300FF' - - uid: 14717 + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15727 components: - type: Transform - rot: 3.141592653589793 rad - pos: -54.5,30.5 - parent: 2 - - type: PointLight - color: '#FF3300FF' + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15728 + components: + - type: Transform + parent: 15720 + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: TelecomServer entities: - uid: 11230 @@ -85506,26 +92038,6 @@ entities: - type: Transform pos: 15.5,-2.5 parent: 2 -- proto: ToiletDirtyWater - entities: - - uid: 5830 - components: - - type: Transform - pos: 2.5,34.5 - parent: 2 - - type: DisposalUnit - nextFlush: 0 - - type: ContainerContainer - containers: - stash: !type:ContainerSlot - showEnts: False - occludes: True - ent: null - disposals: !type:Container - showEnts: False - occludes: True - ents: - - 13056 - proto: ToiletEmpty entities: - uid: 5500 @@ -85558,6 +92070,18 @@ entities: rot: -1.5707963267948966 rad pos: -39.5,-31.5 parent: 2 + - uid: 11615 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 11.5,42.5 + parent: 2 + - uid: 13151 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 0.5,42.5 + parent: 2 - proto: ToolboxElectrical entities: - uid: 6325 @@ -85931,10 +92455,10 @@ entities: parent: 2 - proto: VendingMachineChefvend entities: - - uid: 6706 + - uid: 16006 components: - type: Transform - pos: -19.5,-15.5 + pos: -16.5,-10.5 parent: 2 - proto: VendingMachineChemDrobe entities: @@ -86007,10 +92531,10 @@ entities: parent: 2 - proto: VendingMachineDinnerware entities: - - uid: 6705 + - uid: 6706 components: - type: Transform - pos: -15.5,-15.5 + pos: -19.5,-15.5 parent: 2 - proto: VendingMachineEngiDrobe entities: @@ -86148,10 +92672,10 @@ entities: parent: 2 - proto: VendingMachineSeedsUnlocked entities: - - uid: 5847 + - uid: 11623 components: - type: Transform - pos: 9.5,32.5 + pos: 11.5,39.5 parent: 2 - proto: VendingMachineTankDispenserEngineering entities: @@ -86160,6 +92684,11 @@ entities: - type: Transform pos: -34.5,3.5 parent: 2 + - uid: 14834 + components: + - type: Transform + pos: -46.5,22.5 + parent: 2 - proto: VendingMachineTankDispenserEVA entities: - uid: 1938 @@ -86167,11 +92696,6 @@ entities: - type: Transform pos: -6.5,-40.5 parent: 2 - - uid: 5626 - components: - - type: Transform - pos: 10.5,17.5 - parent: 2 - uid: 8143 components: - type: Transform @@ -86182,6 +92706,16 @@ entities: - type: Transform pos: -33.5,3.5 parent: 2 + - uid: 14833 + components: + - type: Transform + pos: -45.5,22.5 + parent: 2 + - uid: 15031 + components: + - type: Transform + pos: 1.5,9.5 + parent: 2 - proto: VendingMachineTheater entities: - uid: 625 @@ -86244,24 +92778,36 @@ entities: - type: Transform pos: -24.5,19.5 parent: 2 +- proto: VoiceRecorder + entities: + - uid: 15051 + components: + - type: Transform + pos: 0.5252826,14.918869 + parent: 2 - proto: WallmountTelescreen entities: + - uid: 5792 + components: + - type: Transform + pos: 9.5,43.5 + parent: 2 - uid: 8325 components: - type: Transform pos: -59.5,-38.5 parent: 2 + - uid: 8743 + components: + - type: Transform + pos: 2.5,43.5 + parent: 2 - uid: 12691 components: - type: Transform rot: 3.141592653589793 rad pos: -0.5,8.5 parent: 2 - - uid: 12696 - components: - - type: Transform - pos: -0.5,16.5 - parent: 2 - proto: WallmountTelevision entities: - uid: 2105 @@ -86289,6 +92835,11 @@ entities: - type: Transform pos: -8.5,-32.5 parent: 2 + - uid: 15973 + components: + - type: Transform + pos: 6.5,43.5 + parent: 2 - proto: WallReinforced entities: - uid: 8 @@ -86619,6 +93170,11 @@ entities: - type: Transform pos: -53.5,-2.5 parent: 2 + - uid: 237 + components: + - type: Transform + pos: 13.5,14.5 + parent: 2 - uid: 238 components: - type: Transform @@ -86634,6 +93190,11 @@ entities: - type: Transform pos: 2.5,1.5 parent: 2 + - uid: 244 + components: + - type: Transform + pos: 13.5,13.5 + parent: 2 - uid: 245 components: - type: Transform @@ -86669,6 +93230,11 @@ entities: - type: Transform pos: 39.5,2.5 parent: 2 + - uid: 255 + components: + - type: Transform + pos: 13.5,15.5 + parent: 2 - uid: 258 components: - type: Transform @@ -86984,7 +93550,7 @@ entities: - uid: 383 components: - type: Transform - pos: 7.5,18.5 + pos: 13.5,20.5 parent: 2 - uid: 384 components: @@ -87019,7 +93585,7 @@ entities: - uid: 390 components: - type: Transform - pos: 7.5,16.5 + pos: 13.5,16.5 parent: 2 - uid: 391 components: @@ -87203,15 +93769,10 @@ entities: - type: Transform pos: 8.5,20.5 parent: 2 - - uid: 523 - components: - - type: Transform - pos: 11.5,19.5 - parent: 2 - uid: 524 components: - type: Transform - pos: 11.5,18.5 + pos: 13.5,21.5 parent: 2 - uid: 525 components: @@ -87223,11 +93784,6 @@ entities: - type: Transform pos: 9.5,20.5 parent: 2 - - uid: 528 - components: - - type: Transform - pos: 11.5,16.5 - parent: 2 - uid: 530 components: - type: Transform @@ -87246,7 +93802,7 @@ entities: - uid: 534 components: - type: Transform - pos: 11.5,15.5 + pos: 13.5,17.5 parent: 2 - uid: 554 components: @@ -87260,18 +93816,54 @@ entities: rot: 3.141592653589793 rad pos: 13.5,4.5 parent: 2 + - uid: 563 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 10.5,31.5 + parent: 2 + - uid: 565 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 3.5,33.5 + parent: 2 + - uid: 566 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 3.5,31.5 + parent: 2 - uid: 567 components: - type: Transform rot: 3.141592653589793 rad pos: 20.5,15.5 parent: 2 + - uid: 569 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 12.5,33.5 + parent: 2 + - uid: 570 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 12.5,32.5 + parent: 2 - uid: 571 components: - type: Transform rot: 3.141592653589793 rad pos: 14.5,4.5 parent: 2 + - uid: 572 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 12.5,31.5 + parent: 2 - uid: 582 components: - type: Transform @@ -87957,38 +94549,33 @@ entities: - uid: 931 components: - type: Transform - rot: 3.141592653589793 rad pos: -13.5,-18.5 parent: 2 - - uid: 948 + - uid: 935 components: - type: Transform - rot: 3.141592653589793 rad - pos: 3.5,35.5 + pos: -74.5,27.5 parent: 2 - - uid: 953 + - uid: 938 components: - type: Transform - rot: 3.141592653589793 rad - pos: 4.5,35.5 + rot: -1.5707963267948966 rad + pos: -74.5,23.5 parent: 2 - - uid: 958 + - uid: 940 components: - type: Transform - rot: 3.141592653589793 rad - pos: 5.5,35.5 + pos: -58.5,19.5 parent: 2 - - uid: 963 + - uid: 941 components: - type: Transform - rot: 3.141592653589793 rad - pos: 5.5,34.5 + pos: -63.5,23.5 parent: 2 - - uid: 968 + - uid: 946 components: - type: Transform - rot: 3.141592653589793 rad - pos: 5.5,33.5 + pos: -61.5,19.5 parent: 2 - uid: 977 components: @@ -88008,53 +94595,16 @@ entities: rot: 3.141592653589793 rad pos: 0.5,28.5 parent: 2 - - uid: 992 + - uid: 988 components: - type: Transform - rot: 3.141592653589793 rad - pos: 0.5,32.5 - parent: 2 - - uid: 993 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 6.5,33.5 - parent: 2 - - uid: 997 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 0.5,33.5 - parent: 2 - - uid: 998 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 10.5,33.5 + pos: -59.5,19.5 parent: 2 - uid: 1002 components: - type: Transform - rot: 3.141592653589793 rad - pos: 0.5,34.5 - parent: 2 - - uid: 1003 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 11.5,33.5 - parent: 2 - - uid: 1012 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 11.5,32.5 - parent: 2 - - uid: 1016 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 1.5,35.5 + rot: 1.5707963267948966 rad + pos: 12.5,35.5 parent: 2 - uid: 1017 components: @@ -88062,12 +94612,6 @@ entities: rot: 3.141592653589793 rad pos: 11.5,28.5 parent: 2 - - uid: 1021 - components: - - type: Transform - rot: 3.141592653589793 rad - pos: 2.5,35.5 - parent: 2 - uid: 1023 components: - type: Transform @@ -88302,6 +94846,12 @@ entities: rot: 3.141592653589793 rad pos: -6.5,-32.5 parent: 2 + - uid: 1104 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 8.5,33.5 + parent: 2 - uid: 1107 components: - type: Transform @@ -88896,6 +95446,11 @@ entities: - type: Transform pos: -9.5,-44.5 parent: 2 + - uid: 1272 + components: + - type: Transform + pos: -55.5,19.5 + parent: 2 - uid: 1276 components: - type: Transform @@ -89543,7 +96098,7 @@ entities: - uid: 1631 components: - type: Transform - pos: -54.5,20.5 + pos: -62.5,24.5 parent: 2 - uid: 1632 components: @@ -89710,11 +96265,6 @@ entities: - type: Transform pos: -51.5,16.5 parent: 2 - - uid: 1674 - components: - - type: Transform - pos: -51.5,17.5 - parent: 2 - uid: 1681 components: - type: Transform @@ -89849,6 +96399,11 @@ entities: - type: Transform pos: -45.5,-44.5 parent: 2 + - uid: 1773 + components: + - type: Transform + pos: -65.5,23.5 + parent: 2 - uid: 1791 components: - type: Transform @@ -91411,6 +97966,12 @@ entities: - type: Transform pos: -29.5,2.5 parent: 2 + - uid: 2531 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -0.5,33.5 + parent: 2 - uid: 2534 components: - type: Transform @@ -91594,6 +98155,24 @@ entities: - type: Transform pos: 14.5,6.5 parent: 2 + - uid: 4449 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 13.5,40.5 + parent: 2 + - uid: 4452 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 11.5,35.5 + parent: 2 + - uid: 4453 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 11.5,29.5 + parent: 2 - uid: 4541 components: - type: Transform @@ -91689,6 +98268,16 @@ entities: rot: 3.141592653589793 rad pos: -9.5,16.5 parent: 2 + - uid: 5518 + components: + - type: Transform + pos: -57.5,19.5 + parent: 2 + - uid: 5519 + components: + - type: Transform + pos: -60.5,19.5 + parent: 2 - uid: 5562 components: - type: Transform @@ -91706,21 +98295,127 @@ entities: rot: 3.141592653589793 rad pos: -17.5,16.5 parent: 2 + - uid: 5617 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 3.5,43.5 + parent: 2 + - uid: 5690 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 11.5,34.5 + parent: 2 - uid: 5834 components: - type: Transform - pos: 1.5,34.5 + rot: 1.5707963267948966 rad + pos: 13.5,35.5 + parent: 2 + - uid: 5838 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -0.5,43.5 + parent: 2 + - uid: 5839 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 1.5,43.5 + parent: 2 + - uid: 5849 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 12.5,41.5 + parent: 2 + - uid: 5850 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 11.5,43.5 + parent: 2 + - uid: 5861 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -0.5,40.5 + parent: 2 + - uid: 5862 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -0.5,42.5 + parent: 2 + - uid: 5871 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -0.5,41.5 + parent: 2 + - uid: 5901 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 10.5,43.5 parent: 2 - uid: 5903 components: - type: Transform pos: -35.5,-53.5 parent: 2 + - uid: 5913 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 12.5,43.5 + parent: 2 + - uid: 5916 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 0.5,29.5 + parent: 2 + - uid: 5931 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 12.5,40.5 + parent: 2 + - uid: 5934 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 0.5,34.5 + parent: 2 + - uid: 5935 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 0.5,35.5 + parent: 2 + - uid: 5940 + components: + - type: Transform + pos: -69.5,23.5 + parent: 2 + - uid: 5941 + components: + - type: Transform + pos: -62.5,19.5 + parent: 2 - uid: 5950 components: - type: Transform pos: -44.5,33.5 parent: 2 + - uid: 5960 + components: + - type: Transform + pos: -68.5,23.5 + parent: 2 - uid: 5962 components: - type: Transform @@ -91750,11 +98445,21 @@ entities: rot: 3.141592653589793 rad pos: -40.5,31.5 parent: 2 + - uid: 6074 + components: + - type: Transform + pos: -62.5,20.5 + parent: 2 - uid: 6076 components: - type: Transform pos: -41.5,33.5 parent: 2 + - uid: 6106 + components: + - type: Transform + pos: -66.5,23.5 + parent: 2 - uid: 6108 components: - type: Transform @@ -91800,6 +98505,11 @@ entities: rot: 1.5707963267948966 rad pos: -78.5,-3.5 parent: 2 + - uid: 6119 + components: + - type: Transform + pos: -67.5,23.5 + parent: 2 - uid: 6127 components: - type: Transform @@ -92014,6 +98724,12 @@ entities: - type: Transform pos: -40.5,-3.5 parent: 2 + - uid: 6343 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 11.5,31.5 + parent: 2 - uid: 6353 components: - type: Transform @@ -92145,6 +98861,23 @@ entities: - type: Transform pos: -52.5,5.5 parent: 2 + - uid: 6659 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 0.5,31.5 + parent: 2 + - uid: 6719 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -75.5,35.5 + parent: 2 + - uid: 6766 + components: + - type: Transform + pos: -64.5,23.5 + parent: 2 - uid: 6798 components: - type: Transform @@ -92161,6 +98894,17 @@ entities: - type: Transform pos: -37.5,-12.5 parent: 2 + - uid: 6923 + components: + - type: Transform + pos: -70.5,23.5 + parent: 2 + - uid: 6935 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -1.5,37.5 + parent: 2 - uid: 6980 components: - type: Transform @@ -92349,6 +99093,18 @@ entities: - type: Transform pos: -48.5,-12.5 parent: 2 + - uid: 9563 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -57.5,18.5 + parent: 2 + - uid: 9564 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -57.5,17.5 + parent: 2 - uid: 9589 components: - type: Transform @@ -92871,6 +99627,78 @@ entities: rot: 1.5707963267948966 rad pos: -30.5,12.5 parent: 2 + - uid: 11528 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -1.5,38.5 + parent: 2 + - uid: 11560 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -1.5,39.5 + parent: 2 + - uid: 11563 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -0.5,31.5 + parent: 2 + - uid: 11564 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -0.5,32.5 + parent: 2 + - uid: 11567 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 0.5,33.5 + parent: 2 + - uid: 11576 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 8.5,31.5 + parent: 2 + - uid: 11577 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 1.5,31.5 + parent: 2 + - uid: 11583 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -1.5,35.5 + parent: 2 + - uid: 11584 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -0.5,35.5 + parent: 2 + - uid: 11586 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 0.5,43.5 + parent: 2 + - uid: 11588 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -1.5,36.5 + parent: 2 + - uid: 11589 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 11.5,33.5 + parent: 2 - uid: 11598 components: - type: Transform @@ -92881,6 +99709,12 @@ entities: - type: Transform pos: -54.5,-18.5 parent: 2 + - uid: 11604 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 2.5,43.5 + parent: 2 - uid: 11605 components: - type: Transform @@ -92891,6 +99725,12 @@ entities: - type: Transform pos: -56.5,-18.5 parent: 2 + - uid: 11618 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 13.5,37.5 + parent: 2 - uid: 11622 components: - type: Transform @@ -92901,6 +99741,12 @@ entities: - type: Transform pos: -54.5,-22.5 parent: 2 + - uid: 11629 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -75.5,31.5 + parent: 2 - uid: 11630 components: - type: Transform @@ -92911,11 +99757,39 @@ entities: - type: Transform pos: -56.5,-22.5 parent: 2 + - uid: 11635 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 11.5,30.5 + parent: 2 + - uid: 11642 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 13.5,36.5 + parent: 2 + - uid: 11681 + components: + - type: Transform + pos: -70.5,31.5 + parent: 2 - uid: 11688 components: - type: Transform pos: -54.5,5.5 parent: 2 + - uid: 11689 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -78.5,26.5 + parent: 2 + - uid: 11690 + components: + - type: Transform + pos: -54.5,19.5 + parent: 2 - uid: 11691 components: - type: Transform @@ -92976,6 +99850,18 @@ entities: - type: Transform pos: -46.5,34.5 parent: 2 + - uid: 11826 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -57.5,16.5 + parent: 2 + - uid: 11827 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -56.5,16.5 + parent: 2 - uid: 11879 components: - type: Transform @@ -92986,20 +99872,35 @@ entities: - type: Transform pos: -39.5,33.5 parent: 2 + - uid: 11883 + components: + - type: Transform + pos: -74.5,24.5 + parent: 2 - uid: 11887 components: - type: Transform - pos: -54.5,19.5 + pos: -71.5,23.5 parent: 2 - - uid: 11890 + - uid: 11891 components: - type: Transform - pos: -54.5,21.5 + pos: -62.5,22.5 + parent: 2 + - uid: 11892 + components: + - type: Transform + pos: -62.5,21.5 + parent: 2 + - uid: 11893 + components: + - type: Transform + pos: -72.5,23.5 parent: 2 - uid: 11898 components: - type: Transform - pos: -54.5,22.5 + pos: -73.5,23.5 parent: 2 - uid: 12002 components: @@ -93022,11 +99923,6 @@ entities: rot: 3.141592653589793 rad pos: -1.5,-44.5 parent: 2 - - uid: 12248 - components: - - type: Transform - pos: 11.5,17.5 - parent: 2 - uid: 12260 components: - type: Transform @@ -93043,11 +99939,45 @@ entities: rot: -1.5707963267948966 rad pos: -39.5,11.5 parent: 2 + - uid: 12323 + components: + - type: Transform + pos: 2.5,16.5 + parent: 2 + - uid: 12449 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 13.5,38.5 + parent: 2 + - uid: 12511 + components: + - type: Transform + pos: -62.5,23.5 + parent: 2 - uid: 12553 components: - type: Transform pos: 6.5,8.5 parent: 2 + - uid: 12556 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 5.5,43.5 + parent: 2 + - uid: 12563 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 13.5,39.5 + parent: 2 + - uid: 12564 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -1.5,40.5 + parent: 2 - uid: 12599 components: - type: Transform @@ -93068,6 +99998,11 @@ entities: - type: Transform pos: -44.5,36.5 parent: 2 + - uid: 12786 + components: + - type: Transform + pos: -71.5,31.5 + parent: 2 - uid: 12793 components: - type: Transform @@ -93079,12 +100014,30 @@ entities: rot: -1.5707963267948966 rad pos: 15.5,-8.5 parent: 2 + - uid: 13056 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 4.5,43.5 + parent: 2 + - uid: 13070 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 8.5,43.5 + parent: 2 - uid: 13097 components: - type: Transform rot: -1.5707963267948966 rad pos: -52.5,-11.5 parent: 2 + - uid: 13152 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 9.5,43.5 + parent: 2 - uid: 13171 components: - type: Transform @@ -93167,11 +100120,40 @@ entities: - type: Transform pos: -42.5,23.5 parent: 2 + - uid: 14074 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 6.5,43.5 + parent: 2 + - uid: 14075 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 7.5,43.5 + parent: 2 + - uid: 14076 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 12.5,42.5 + parent: 2 + - uid: 14194 + components: + - type: Transform + pos: -1.5,9.5 + parent: 2 - uid: 14217 components: - type: Transform pos: -48.5,38.5 parent: 2 + - uid: 14294 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 0.5,30.5 + parent: 2 - uid: 14545 components: - type: Transform @@ -93183,6 +100165,645 @@ entities: - type: Transform pos: -40.5,4.5 parent: 2 + - uid: 14704 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -52.5,16.5 + parent: 2 + - uid: 14705 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -54.5,16.5 + parent: 2 + - uid: 14708 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -55.5,16.5 + parent: 2 + - uid: 14824 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -62.5,26.5 + parent: 2 + - uid: 14827 + components: + - type: Transform + pos: -79.5,30.5 + parent: 2 + - uid: 14837 + components: + - type: Transform + pos: -70.5,27.5 + parent: 2 + - uid: 14838 + components: + - type: Transform + pos: -69.5,27.5 + parent: 2 + - uid: 14839 + components: + - type: Transform + pos: -68.5,27.5 + parent: 2 + - uid: 14840 + components: + - type: Transform + pos: -67.5,27.5 + parent: 2 + - uid: 14841 + components: + - type: Transform + pos: -66.5,27.5 + parent: 2 + - uid: 14842 + components: + - type: Transform + pos: -65.5,27.5 + parent: 2 + - uid: 14843 + components: + - type: Transform + pos: -64.5,27.5 + parent: 2 + - uid: 14844 + components: + - type: Transform + pos: -63.5,27.5 + parent: 2 + - uid: 14845 + components: + - type: Transform + pos: -62.5,27.5 + parent: 2 + - uid: 14846 + components: + - type: Transform + pos: -61.5,27.5 + parent: 2 + - uid: 14847 + components: + - type: Transform + pos: -60.5,27.5 + parent: 2 + - uid: 14848 + components: + - type: Transform + pos: -59.5,27.5 + parent: 2 + - uid: 14849 + components: + - type: Transform + pos: -66.5,35.5 + parent: 2 + - uid: 14852 + components: + - type: Transform + pos: -74.5,26.5 + parent: 2 + - uid: 14853 + components: + - type: Transform + pos: -73.5,31.5 + parent: 2 + - uid: 14854 + components: + - type: Transform + pos: -69.5,31.5 + parent: 2 + - uid: 14856 + components: + - type: Transform + pos: -70.5,35.5 + parent: 2 + - uid: 14857 + components: + - type: Transform + pos: -69.5,35.5 + parent: 2 + - uid: 14858 + components: + - type: Transform + pos: -71.5,35.5 + parent: 2 + - uid: 14859 + components: + - type: Transform + pos: -74.5,35.5 + parent: 2 + - uid: 14861 + components: + - type: Transform + pos: -73.5,35.5 + parent: 2 + - uid: 14866 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 8.5,15.5 + parent: 2 + - uid: 14888 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -76.5,37.5 + parent: 2 + - uid: 14892 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -66.5,28.5 + parent: 2 + - uid: 14904 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -75.5,37.5 + parent: 2 + - uid: 14905 + components: + - type: Transform + pos: 3.5,16.5 + parent: 2 + - uid: 14920 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -66.5,29.5 + parent: 2 + - uid: 14922 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -66.5,30.5 + parent: 2 + - uid: 14923 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -66.5,31.5 + parent: 2 + - uid: 14924 + components: + - type: Transform + pos: -78.5,34.5 + parent: 2 + - uid: 14927 + components: + - type: Transform + pos: -77.5,37.5 + parent: 2 + - uid: 14928 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -66.5,36.5 + parent: 2 + - uid: 14929 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -78.5,36.5 + parent: 2 + - uid: 14930 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -78.5,35.5 + parent: 2 + - uid: 14932 + components: + - type: Transform + pos: -66.5,32.5 + parent: 2 + - uid: 14934 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -78.5,31.5 + parent: 2 + - uid: 14935 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -78.5,30.5 + parent: 2 + - uid: 14936 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -78.5,29.5 + parent: 2 + - uid: 14937 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -78.5,28.5 + parent: 2 + - uid: 14938 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -77.5,23.5 + parent: 2 + - uid: 14939 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -78.5,24.5 + parent: 2 + - uid: 14940 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -78.5,23.5 + parent: 2 + - uid: 14941 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -78.5,25.5 + parent: 2 + - uid: 14942 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -74.5,25.5 + parent: 2 + - uid: 14943 + components: + - type: Transform + pos: -74.5,38.5 + parent: 2 + - uid: 14944 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -78.5,37.5 + parent: 2 + - uid: 14945 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -78.5,27.5 + parent: 2 + - uid: 14946 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -76.5,23.5 + parent: 2 + - uid: 14947 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -75.5,23.5 + parent: 2 + - uid: 14949 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -66.5,37.5 + parent: 2 + - uid: 14950 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -67.5,37.5 + parent: 2 + - uid: 14951 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -68.5,37.5 + parent: 2 + - uid: 14952 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -69.5,37.5 + parent: 2 + - uid: 14953 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -69.5,38.5 + parent: 2 + - uid: 14954 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -70.5,38.5 + parent: 2 + - uid: 14955 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -53.5,16.5 + parent: 2 + - uid: 14959 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -75.5,38.5 + parent: 2 + - uid: 15019 + components: + - type: Transform + pos: 13.5,18.5 + parent: 2 + - uid: 15020 + components: + - type: Transform + pos: 13.5,19.5 + parent: 2 + - uid: 15029 + components: + - type: Transform + pos: 8.5,19.5 + parent: 2 + - uid: 15030 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: -54.5,21.5 + parent: 2 + - uid: 15044 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 8.5,16.5 + parent: 2 + - uid: 15058 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 8.5,18.5 + parent: 2 + - uid: 15149 + components: + - type: Transform + pos: -69.5,24.5 + parent: 2 + - uid: 15150 + components: + - type: Transform + pos: -69.5,26.5 + parent: 2 + - uid: 15241 + components: + - type: Transform + pos: -66.5,40.5 + parent: 2 + - uid: 15257 + components: + - type: Transform + pos: -80.5,29.5 + parent: 2 + - uid: 15258 + components: + - type: Transform + pos: -80.5,34.5 + parent: 2 + - uid: 15263 + components: + - type: Transform + pos: -80.5,31.5 + parent: 2 + - uid: 15264 + components: + - type: Transform + pos: -80.5,30.5 + parent: 2 + - uid: 15269 + components: + - type: Transform + pos: -80.5,33.5 + parent: 2 + - uid: 15311 + components: + - type: Transform + pos: -72.5,38.5 + parent: 2 + - uid: 15312 + components: + - type: Transform + pos: -78.5,32.5 + parent: 2 + - uid: 15313 + components: + - type: Transform + pos: -78.5,33.5 + parent: 2 + - uid: 15316 + components: + - type: Transform + pos: -66.5,34.5 + parent: 2 + - uid: 15317 + components: + - type: Transform + pos: -66.5,33.5 + parent: 2 + - uid: 15320 + components: + - type: Transform + pos: -80.5,35.5 + parent: 2 + - uid: 15335 + components: + - type: Transform + pos: -80.5,32.5 + parent: 2 + - uid: 15338 + components: + - type: Transform + pos: -80.5,36.5 + parent: 2 + - uid: 15339 + components: + - type: Transform + pos: -80.5,37.5 + parent: 2 + - uid: 15340 + components: + - type: Transform + pos: -77.5,39.5 + parent: 2 + - uid: 15341 + components: + - type: Transform + pos: -67.5,40.5 + parent: 2 + - uid: 15344 + components: + - type: Transform + pos: -76.5,40.5 + parent: 2 + - uid: 15345 + components: + - type: Transform + pos: -75.5,40.5 + parent: 2 + - uid: 15346 + components: + - type: Transform + pos: -74.5,40.5 + parent: 2 + - uid: 15347 + components: + - type: Transform + pos: -73.5,40.5 + parent: 2 + - uid: 15348 + components: + - type: Transform + pos: -72.5,40.5 + parent: 2 + - uid: 15349 + components: + - type: Transform + pos: -71.5,40.5 + parent: 2 + - uid: 15350 + components: + - type: Transform + pos: -70.5,40.5 + parent: 2 + - uid: 15351 + components: + - type: Transform + pos: -69.5,40.5 + parent: 2 + - uid: 15352 + components: + - type: Transform + pos: -68.5,40.5 + parent: 2 + - uid: 15353 + components: + - type: Transform + pos: -77.5,40.5 + parent: 2 + - uid: 15354 + components: + - type: Transform + pos: -79.5,36.5 + parent: 2 + - uid: 15355 + components: + - type: Transform + pos: -78.5,40.5 + parent: 2 + - uid: 15356 + components: + - type: Transform + pos: -67.5,39.5 + parent: 2 + - uid: 15357 + components: + - type: Transform + pos: -67.5,38.5 + parent: 2 + - uid: 15358 + components: + - type: Transform + pos: -65.5,36.5 + parent: 2 + - uid: 15359 + components: + - type: Transform + pos: -64.5,36.5 + parent: 2 + - uid: 15360 + components: + - type: Transform + pos: -65.5,30.5 + parent: 2 + - uid: 15361 + components: + - type: Transform + pos: -64.5,29.5 + parent: 2 + - uid: 15362 + components: + - type: Transform + pos: -64.5,30.5 + parent: 2 + - uid: 15363 + components: + - type: Transform + pos: -64.5,31.5 + parent: 2 + - uid: 15364 + components: + - type: Transform + pos: -64.5,32.5 + parent: 2 + - uid: 15365 + components: + - type: Transform + pos: -64.5,33.5 + parent: 2 + - uid: 15366 + components: + - type: Transform + pos: -64.5,34.5 + parent: 2 + - uid: 15367 + components: + - type: Transform + pos: -64.5,35.5 + parent: 2 + - uid: 15368 + components: + - type: Transform + pos: -64.5,37.5 + parent: 2 + - uid: 15438 + components: + - type: Transform + pos: -68.5,38.5 + parent: 2 + - uid: 15611 + components: + - type: Transform + pos: -77.5,38.5 + parent: 2 + - uid: 15612 + components: + - type: Transform + pos: -76.5,38.5 + parent: 2 + - uid: 15622 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: -74.5,31.5 + parent: 2 + - uid: 15935 + components: + - type: Transform + pos: -1.5,10.5 + parent: 2 + - uid: 15940 + components: + - type: Transform + pos: -1.5,11.5 + parent: 2 + - uid: 15941 + components: + - type: Transform + pos: 2.5,15.5 + parent: 2 + - uid: 15942 + components: + - type: Transform + pos: 2.5,12.5 + parent: 2 - proto: WallRock entities: - uid: 836 @@ -93202,41 +100823,6 @@ entities: - type: Transform pos: -22.5,-61.5 parent: 2 - - uid: 556 - components: - - type: Transform - pos: -1.5,34.5 - parent: 2 - - uid: 560 - components: - - type: Transform - pos: 3.5,39.5 - parent: 2 - - uid: 564 - components: - - type: Transform - pos: 4.5,39.5 - parent: 2 - - uid: 565 - components: - - type: Transform - pos: 5.5,38.5 - parent: 2 - - uid: 572 - components: - - type: Transform - pos: 7.5,36.5 - parent: 2 - - uid: 601 - components: - - type: Transform - pos: 12.5,35.5 - parent: 2 - - uid: 614 - components: - - type: Transform - pos: 11.5,42.5 - parent: 2 - uid: 801 components: - type: Transform @@ -93272,11 +100858,6 @@ entities: - type: Transform pos: -41.5,41.5 parent: 2 - - uid: 988 - components: - - type: Transform - pos: -55.5,19.5 - parent: 2 - uid: 1034 components: - type: Transform @@ -93427,23 +101008,73 @@ entities: - type: Transform pos: -57.5,39.5 parent: 2 + - uid: 15259 + components: + - type: Transform + pos: -67.5,21.5 + parent: 2 + - uid: 15306 + components: + - type: Transform + pos: -66.5,20.5 + parent: 2 + - uid: 15422 + components: + - type: Transform + pos: -82.5,36.5 + parent: 2 + - uid: 15434 + components: + - type: Transform + pos: -82.5,30.5 + parent: 2 + - uid: 15436 + components: + - type: Transform + pos: -83.5,32.5 + parent: 2 + - uid: 15444 + components: + - type: Transform + pos: -80.5,39.5 + parent: 2 + - uid: 15796 + components: + - type: Transform + pos: -1.5,33.5 + parent: 2 + - uid: 15805 + components: + - type: Transform + pos: -3.5,38.5 + parent: 2 + - uid: 15832 + components: + - type: Transform + pos: 11.5,45.5 + parent: 2 + - uid: 15870 + components: + - type: Transform + pos: 1.5,46.5 + parent: 2 + - uid: 15886 + components: + - type: Transform + pos: 5.5,48.5 + parent: 2 + - uid: 15905 + components: + - type: Transform + pos: 15.5,38.5 + parent: 2 + - uid: 15910 + components: + - type: Transform + pos: 14.5,37.5 + parent: 2 - proto: WallRockPlasma entities: - - uid: 568 - components: - - type: Transform - pos: 10.5,35.5 - parent: 2 - - uid: 620 - components: - - type: Transform - pos: 9.5,36.5 - parent: 2 - - uid: 626 - components: - - type: Transform - pos: 10.5,36.5 - parent: 2 - uid: 687 components: - type: Transform @@ -93504,15 +101135,35 @@ entities: - type: Transform pos: 12.5,-38.5 parent: 2 - - uid: 8824 + - uid: 14926 components: - type: Transform - pos: 10.5,34.5 + pos: -65.5,22.5 parent: 2 - - uid: 12239 + - uid: 15303 components: - type: Transform - pos: 11.5,34.5 + pos: -64.5,20.5 + parent: 2 + - uid: 15450 + components: + - type: Transform + pos: -78.5,41.5 + parent: 2 + - uid: 15483 + components: + - type: Transform + pos: -72.5,43.5 + parent: 2 + - uid: 15492 + components: + - type: Transform + pos: -64.5,40.5 + parent: 2 + - uid: 15518 + components: + - type: Transform + pos: -63.5,39.5 parent: 2 - proto: WallRockQuartz entities: @@ -93531,26 +101182,6 @@ entities: - type: Transform pos: -37.5,20.5 parent: 2 - - uid: 559 - components: - - type: Transform - pos: 3.5,40.5 - parent: 2 - - uid: 562 - components: - - type: Transform - pos: 3.5,38.5 - parent: 2 - - uid: 615 - components: - - type: Transform - pos: 10.5,38.5 - parent: 2 - - uid: 619 - components: - - type: Transform - pos: 9.5,37.5 - parent: 2 - uid: 768 components: - type: Transform @@ -93606,36 +101237,16 @@ entities: - type: Transform pos: -42.5,43.5 parent: 2 - - uid: 938 - components: - - type: Transform - pos: -60.5,24.5 - parent: 2 - uid: 1009 components: - type: Transform pos: -58.5,28.5 parent: 2 - - uid: 1019 - components: - - type: Transform - pos: -52.5,16.5 - parent: 2 - - uid: 1031 - components: - - type: Transform - pos: -56.5,18.5 - parent: 2 - uid: 1032 components: - type: Transform pos: -54.5,11.5 parent: 2 - - uid: 1033 - components: - - type: Transform - pos: -55.5,16.5 - parent: 2 - uid: 1242 components: - type: Transform @@ -93731,26 +101342,86 @@ entities: - type: Transform pos: 12.5,-35.5 parent: 2 - - uid: 5941 - components: - - type: Transform - pos: -59.5,25.5 - parent: 2 - uid: 11685 components: - type: Transform pos: -56.5,9.5 parent: 2 - - uid: 11827 - components: - - type: Transform - pos: -60.5,34.5 - parent: 2 - uid: 11839 components: - type: Transform pos: -59.5,35.5 parent: 2 + - uid: 15278 + components: + - type: Transform + pos: -61.5,18.5 + parent: 2 + - uid: 15315 + components: + - type: Transform + pos: -71.5,21.5 + parent: 2 + - uid: 15329 + components: + - type: Transform + pos: -72.5,22.5 + parent: 2 + - uid: 15457 + components: + - type: Transform + pos: -75.5,42.5 + parent: 2 + - uid: 15479 + components: + - type: Transform + pos: -76.5,43.5 + parent: 2 + - uid: 15489 + components: + - type: Transform + pos: -66.5,43.5 + parent: 2 + - uid: 15514 + components: + - type: Transform + pos: -62.5,30.5 + parent: 2 + - uid: 15803 + components: + - type: Transform + pos: -2.5,40.5 + parent: 2 + - uid: 15809 + components: + - type: Transform + pos: -3.5,42.5 + parent: 2 + - uid: 15864 + components: + - type: Transform + pos: 10.5,47.5 + parent: 2 + - uid: 15883 + components: + - type: Transform + pos: 8.5,48.5 + parent: 2 + - uid: 15887 + components: + - type: Transform + pos: 11.5,48.5 + parent: 2 + - uid: 15899 + components: + - type: Transform + pos: 13.5,43.5 + parent: 2 + - uid: 15903 + components: + - type: Transform + pos: 15.5,40.5 + parent: 2 - proto: WallRockSalt entities: - uid: 913 @@ -93758,58 +101429,23 @@ entities: - type: Transform pos: -46.5,43.5 parent: 2 + - uid: 11905 + components: + - type: Transform + pos: -61.5,29.5 + parent: 2 - uid: 11978 components: - type: Transform pos: -51.5,44.5 parent: 2 + - uid: 15469 + components: + - type: Transform + pos: -69.5,42.5 + parent: 2 - proto: WallRockTin entities: - - uid: 557 - components: - - type: Transform - pos: 1.5,42.5 - parent: 2 - - uid: 558 - components: - - type: Transform - pos: 1.5,39.5 - parent: 2 - - uid: 563 - components: - - type: Transform - pos: 4.5,36.5 - parent: 2 - - uid: 566 - components: - - type: Transform - pos: 6.5,37.5 - parent: 2 - - uid: 569 - components: - - type: Transform - pos: 9.5,35.5 - parent: 2 - - uid: 570 - components: - - type: Transform - pos: 8.5,35.5 - parent: 2 - - uid: 609 - components: - - type: Transform - pos: 8.5,36.5 - parent: 2 - - uid: 610 - components: - - type: Transform - pos: 11.5,41.5 - parent: 2 - - uid: 644 - components: - - type: Transform - pos: 13.5,34.5 - parent: 2 - uid: 775 components: - type: Transform @@ -93935,15 +101571,65 @@ entities: - type: Transform pos: 18.5,23.5 parent: 2 - - uid: 11681 + - uid: 11904 components: - type: Transform - pos: -59.5,21.5 + pos: -41.5,35.5 parent: 2 - - uid: 11690 + - uid: 14825 components: - type: Transform - pos: -58.5,20.5 + pos: -75.5,21.5 + parent: 2 + - uid: 15304 + components: + - type: Transform + pos: -64.5,21.5 + parent: 2 + - uid: 15322 + components: + - type: Transform + pos: -76.5,22.5 + parent: 2 + - uid: 15394 + components: + - type: Transform + pos: -79.5,26.5 + parent: 2 + - uid: 15402 + components: + - type: Transform + pos: -80.5,24.5 + parent: 2 + - uid: 15410 + components: + - type: Transform + pos: -81.5,27.5 + parent: 2 + - uid: 15447 + components: + - type: Transform + pos: -78.5,38.5 + parent: 2 + - uid: 15462 + components: + - type: Transform + pos: -72.5,41.5 + parent: 2 + - uid: 15464 + components: + - type: Transform + pos: -71.5,41.5 + parent: 2 + - uid: 15508 + components: + - type: Transform + pos: -62.5,36.5 + parent: 2 + - uid: 15522 + components: + - type: Transform + pos: -63.5,35.5 parent: 2 - proto: WallSolid entities: @@ -94458,21 +102144,11 @@ entities: - type: Transform pos: 17.5,11.5 parent: 2 - - uid: 2223 - components: - - type: Transform - pos: 14.5,17.5 - parent: 2 - uid: 2224 components: - type: Transform pos: 17.5,9.5 parent: 2 - - uid: 2225 - components: - - type: Transform - pos: 14.5,19.5 - parent: 2 - uid: 2226 components: - type: Transform @@ -94548,11 +102224,6 @@ entities: - type: Transform pos: 16.5,17.5 parent: 2 - - uid: 2252 - components: - - type: Transform - pos: 14.5,18.5 - parent: 2 - uid: 2253 components: - type: Transform @@ -94848,26 +102519,6 @@ entities: rot: -1.5707963267948966 rad pos: -13.5,-5.5 parent: 2 - - uid: 2531 - components: - - type: Transform - pos: 5.5,32.5 - parent: 2 - - uid: 2532 - components: - - type: Transform - pos: 4.5,32.5 - parent: 2 - - uid: 2533 - components: - - type: Transform - pos: 3.5,32.5 - parent: 2 - - uid: 2542 - components: - - type: Transform - pos: 2.5,32.5 - parent: 2 - uid: 2543 components: - type: Transform @@ -95789,6 +103440,12 @@ entities: - type: Transform pos: -50.5,-19.5 parent: 2 + - uid: 11578 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 3.5,40.5 + parent: 2 - uid: 11593 components: - type: Transform @@ -95805,6 +103462,11 @@ entities: - type: Transform pos: -51.5,-8.5 parent: 2 + - uid: 11611 + components: + - type: Transform + pos: 8.5,40.5 + parent: 2 - uid: 11612 components: - type: Transform @@ -96496,6 +104158,16 @@ entities: - type: Transform pos: 9.5,-18.5 parent: 2 + - uid: 12704 + components: + - type: Transform + pos: 2.5,12.5 + parent: 2 + - uid: 12705 + components: + - type: Transform + pos: 2.5,15.5 + parent: 2 - uid: 12739 components: - type: Transform @@ -96615,6 +104287,21 @@ entities: rot: 1.5707963267948966 rad pos: -0.5,-10.5 parent: 2 + - uid: 15032 + components: + - type: Transform + pos: 15.5,18.5 + parent: 2 + - uid: 15946 + components: + - type: Transform + pos: 1.5,12.5 + parent: 2 + - uid: 15954 + components: + - type: Transform + pos: 2.5,15.5 + parent: 2 - proto: WallSolidRust entities: - uid: 14790 @@ -96640,6 +104327,48 @@ entities: - type: Transform pos: 4.5,16.5 parent: 2 +- proto: WallWood + entities: + - uid: 11842 + components: + - type: Transform + pos: -59.5,34.5 + parent: 2 + - uid: 11845 + components: + - type: Transform + pos: -61.5,31.5 + parent: 2 + - uid: 11910 + components: + - type: Transform + pos: -59.5,32.5 + parent: 2 + - uid: 14958 + components: + - type: Transform + pos: -62.5,33.5 + parent: 2 + - uid: 15512 + components: + - type: Transform + pos: -59.5,33.5 + parent: 2 + - uid: 15532 + components: + - type: Transform + pos: -60.5,31.5 + parent: 2 + - uid: 15533 + components: + - type: Transform + pos: -61.5,35.5 + parent: 2 + - uid: 15538 + components: + - type: Transform + pos: -60.5,35.5 + parent: 2 - proto: WardrobeBlack entities: - uid: 8906 @@ -96749,28 +104478,17 @@ entities: ent: null - proto: WardrobeBlackFilled entities: - - uid: 8171 + - uid: 15233 components: - type: Transform - pos: -63.5,-6.5 + pos: -63.5,-8.5 parent: 2 - - type: ContainerContainer - containers: - entity_storage: !type:Container - showEnts: False - occludes: True - ents: - - 8172 - paper_label: !type:ContainerSlot - showEnts: False - occludes: True - ent: null - proto: WardrobeBlueFilled entities: - - uid: 8361 + - uid: 15070 components: - type: Transform - pos: -58.5,-5.5 + pos: -63.5,-7.5 parent: 2 - proto: WardrobeCargoFilled entities: @@ -96806,44 +104524,74 @@ entities: - type: Transform pos: -6.5,-20.5 parent: 2 +- proto: WardrobeGreyFilled + entities: + - uid: 15067 + components: + - type: Transform + pos: -63.5,-6.5 + parent: 2 +- proto: WardrobeMixedFilled + entities: + - uid: 15071 + components: + - type: Transform + pos: -58.5,-5.5 + parent: 2 - proto: WardrobePinkFilled entities: - - uid: 8176 + - uid: 15069 components: - type: Transform pos: -58.5,-4.5 parent: 2 -- proto: WardrobePrisonFilled +- proto: WardrobePrison entities: - - uid: 8738 + - uid: 15630 components: - type: Transform - pos: 2.5,10.5 - parent: 2 - - uid: 8739 - components: - - type: Transform - pos: 2.5,14.5 - parent: 2 -- proto: WardrobeWhiteFilled - entities: - - uid: 8169 - components: - - type: Transform - pos: -63.5,-8.5 - parent: 2 - - uid: 8450 - components: - - type: Transform - pos: -58.5,-6.5 - parent: 2 -- proto: WardrobeYellowFilled - entities: - - uid: 8170 - components: - - type: Transform - pos: -63.5,-7.5 + pos: 2.5,39.5 parent: 2 + - type: ContainerContainer + containers: + entity_storage: !type:Container + showEnts: False + occludes: True + ents: + - 5739 + - 5737 + - 5734 + - 15638 + - 15637 + - 5733 + - 5709 + - 5705 + - 5691 + - 5677 + - 3853 + - 2496 + - 2452 + - 2194 + - 2106 + - 15639 + - 2071 + - 1995 + - 15636 + - 15635 + - 15634 + - 15633 + - 15632 + - 1903 + - 1120 + - 1119 + - 15631 + - 1118 + - 1117 + - 5738 + paper_label: !type:ContainerSlot + showEnts: False + occludes: True + ent: null - proto: WarpPointBombing entities: - uid: 2634 @@ -96890,10 +104638,10 @@ entities: location: Снабжение - proto: WaterCooler entities: - - uid: 5831 + - uid: 5801 components: - type: Transform - pos: 6.5,32.5 + pos: 2.5,11.5 parent: 2 - uid: 7064 components: @@ -96976,24 +104724,31 @@ entities: parent: 2 - proto: WeaponEgun entities: - - uid: 5762 + - uid: 12395 components: - type: Transform - parent: 5947 + parent: 15046 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 8734 + - uid: 12489 components: - type: Transform - parent: 5947 + parent: 15046 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 11454 + - uid: 15047 components: - type: Transform - parent: 5947 + parent: 15046 + - type: Physics + canCollide: False + - type: InsideEntityStorage + - uid: 15048 + components: + - type: Transform + parent: 15046 - type: Physics canCollide: False - type: InsideEntityStorage @@ -97013,6 +104768,13 @@ entities: - type: Physics canCollide: False - type: InsideEntityStorage +- proto: WeaponLaserGun + entities: + - uid: 11848 + components: + - type: Transform + pos: -60.47788,32.57927 + parent: 2 - proto: WeaponRifleAk entities: - uid: 8783 @@ -97024,20 +104786,32 @@ entities: - type: InsideEntityStorage - proto: WeaponRifleLecter entities: - - uid: 12414 + - uid: 15040 components: - type: Transform - parent: 13129 + parent: 15037 - type: Physics canCollide: False - type: InsideEntityStorage - - uid: 12458 + - uid: 15041 components: - type: Transform - parent: 13129 + parent: 15037 - type: Physics canCollide: False - type: InsideEntityStorage +- proto: WeaponShotgunDoubleBarreledRubber + entities: + - uid: 13484 + components: + - type: Transform + pos: 7.5969443,33.60461 + parent: 2 + - uid: 16003 + components: + - type: Transform + pos: 7.6112313,33.558178 + parent: 2 - proto: WeaponShotgunHandmade entities: - uid: 12244 @@ -97048,7 +104822,7 @@ entities: parent: 2 - proto: WeaponShotgunKammerer entities: - - uid: 5677 + - uid: 535 components: - type: Transform parent: 6720 @@ -97078,6 +104852,13 @@ entities: - type: Physics canCollide: False - type: InsideEntityStorage + - uid: 15028 + components: + - type: Transform + parent: 6721 + - type: Physics + canCollide: False + - type: InsideEntityStorage - proto: WelderIndustrial entities: - uid: 14574 @@ -97161,7 +104942,7 @@ entities: pos: -6.5,-20.5 parent: 2 - type: Door - secondsUntilStateChange: -53502.117 + secondsUntilStateChange: -78172.72 state: Opening - proto: WindoorAssembly entities: @@ -97415,6 +105196,18 @@ entities: parent: 2 - proto: WindoorSecureSecurityLocked entities: + - uid: 568 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 7.5,33.5 + parent: 2 + - uid: 1018 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 7.5,32.5 + parent: 2 - uid: 8261 components: - type: Transform @@ -97566,6 +105359,36 @@ entities: rot: 3.141592653589793 rad pos: -40.5,-36.5 parent: 2 + - uid: 4451 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 2.5,40.5 + parent: 2 + - uid: 5848 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 3.5,42.5 + parent: 2 + - uid: 5851 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 8.5,42.5 + parent: 2 + - uid: 5914 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 11.5,40.5 + parent: 2 + - uid: 5919 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 8.5,41.5 + parent: 2 - uid: 6330 components: - type: Transform @@ -97577,6 +105400,12 @@ entities: rot: -1.5707963267948966 rad pos: -1.5,-9.5 parent: 2 + - uid: 6665 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 0.5,40.5 + parent: 2 - uid: 6746 components: - type: Transform @@ -97616,6 +105445,18 @@ entities: - type: Transform pos: -13.5,-24.5 parent: 2 + - uid: 11620 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 9.5,40.5 + parent: 2 + - uid: 11626 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 3.5,41.5 + parent: 2 - proto: WindowDirectional entities: - uid: 1057 @@ -97636,12 +105477,6 @@ entities: rot: 1.5707963267948966 rad pos: -78.5,-6.5 parent: 2 - - uid: 5840 - components: - - type: Transform - rot: 1.5707963267948966 rad - pos: 3.5,34.5 - parent: 2 - uid: 6769 components: - type: Transform @@ -97714,6 +105549,11 @@ entities: - type: Transform pos: -34.5,-16.5 parent: 2 + - uid: 15049 + components: + - type: Transform + pos: 5.5,8.5 + parent: 2 - proto: WindowFrostedDirectional entities: - uid: 6794 @@ -97797,12 +105637,24 @@ entities: - type: Transform pos: -10.5,23.5 parent: 2 + - uid: 1021 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 7.5,33.5 + parent: 2 - uid: 2940 components: - type: Transform rot: 1.5707963267948966 rad pos: -22.5,-5.5 parent: 2 + - uid: 5830 + components: + - type: Transform + rot: 3.141592653589793 rad + pos: 4.5,33.5 + parent: 2 - uid: 6648 components: - type: Transform @@ -97821,6 +105673,12 @@ entities: rot: 1.5707963267948966 rad pos: 3.5,-8.5 parent: 2 + - uid: 9902 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: 3.5,29.5 + parent: 2 - uid: 11264 components: - type: Transform @@ -97851,12 +105709,30 @@ entities: rot: 3.141592653589793 rad pos: -45.5,5.5 parent: 2 + - uid: 11572 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 8.5,29.5 + parent: 2 + - uid: 12707 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 1.5,9.5 + parent: 2 - uid: 13931 components: - type: Transform rot: 3.141592653589793 rad pos: -47.5,5.5 parent: 2 + - uid: 15949 + components: + - type: Transform + rot: 1.5707963267948966 rad + pos: 1.5,11.5 + parent: 2 - proto: Wirecutter entities: - uid: 3233 @@ -97878,6 +105754,13 @@ entities: rot: 3.141592653589793 rad pos: -39.5,-40.5 parent: 2 +- proto: WoodenSupportWall + entities: + - uid: 15536 + components: + - type: Transform + pos: -62.5,34.5 + parent: 2 - proto: Wrench entities: - uid: 14615 diff --git a/Resources/Maps/White/WonderBox.yml b/Resources/Maps/White/WonderBox.yml index 5456e6f4cf..dc0f8d425b 100644 --- a/Resources/Maps/White/WonderBox.yml +++ b/Resources/Maps/White/WonderBox.yml @@ -22599,6 +22599,21 @@ entities: parent: 2 - proto: Bola entities: + - uid: 15785 + components: + - type: Transform + pos: -16.008087,52.70469 + parent: 2 + - uid: 15786 + components: + - type: Transform + pos: -15.883086,52.60045 + parent: 2 + - uid: 15808 + components: + - type: Transform + pos: -15.737252,52.746384 + parent: 2 - uid: 15989 components: - type: Transform @@ -74162,23 +74177,6 @@ entities: - type: Transform pos: 66.5,-59.5 parent: 2 -- proto: Bola - entities: - - uid: 15785 - components: - - type: Transform - pos: -15.931884,52.728363 - parent: 2 - - uid: 15786 - components: - - type: Transform - pos: -15.885009,52.478363 - parent: 2 - - uid: 15808 - components: - - type: Transform - pos: -15.619384,52.650238 - parent: 2 - proto: d20Dice entities: - uid: 9515 @@ -127001,6 +126999,11 @@ entities: - type: Transform pos: 10.5,-0.5 parent: 2 + - uid: 16546 + components: + - type: Transform + pos: 27.5,0.5 + parent: 2 - uid: 16547 components: - type: Transform @@ -129818,6 +129821,11 @@ entities: - type: Transform pos: 59.5,-2.5 parent: 2 + - uid: 18913 + components: + - type: Transform + pos: 4.5,-40.5 + parent: 2 - proto: ProtolatheMachineCircuitboard entities: - uid: 16922 @@ -146917,14 +146925,6 @@ entities: rot: 1.5707963267948966 rad pos: -59.5,5.5 parent: 2 -- proto: SurvivalKnife - entities: - - uid: 19231 - components: - - type: Transform - parent: 19230 - - type: Physics - canCollide: False - proto: SynthesizerInstrument entities: - uid: 16 @@ -150693,22 +150693,12 @@ entities: parent: 2 - proto: ToiletEmpty entities: - - uid: 19230 + - uid: 16721 components: - type: Transform - rot: -1.5707963267948966 rad + rot: 3.141592653589793 rad pos: -35.5,38.5 parent: 2 - - type: ContainerContainer - containers: - stash: !type:ContainerSlot - showEnts: False - occludes: True - ent: 19231 - disposals: !type:Container - showEnts: False - occludes: True - ents: [] - uid: 19840 components: - type: Transform @@ -174139,6 +174129,12 @@ entities: parent: 2 - proto: WindoorSecureArmoryLocked entities: + - uid: 18569 + components: + - type: Transform + rot: -1.5707963267948966 rad + pos: -8.5,50.5 + parent: 2 - uid: 23349 components: - type: Transform @@ -174201,12 +174197,6 @@ entities: - type: Transform pos: 11.5,48.5 parent: 2 - - uid: 23358 - components: - - type: Transform - rot: -1.5707963267948966 rad - pos: -8.5,50.5 - parent: 2 - uid: 23395 components: - type: Transform From 541c463098a56316a181bc3f89fb838643ed7fa4 Mon Sep 17 00:00:00 2001 From: RavmorganButOnCocaine Date: Tue, 23 Jul 2024 02:04:36 +0000 Subject: [PATCH 4/6] Automatic changelog update --- Resources/Changelog/ChangelogWhite.yml | 11 +++++++++++ 1 file changed, 11 insertions(+) diff --git a/Resources/Changelog/ChangelogWhite.yml b/Resources/Changelog/ChangelogWhite.yml index e636ad0148..64e562bfee 100644 --- a/Resources/Changelog/ChangelogWhite.yml +++ b/Resources/Changelog/ChangelogWhite.yml @@ -6452,3 +6452,14 @@ id: 409 time: '2024-07-22T17:06:02.0000000+00:00' url: https://api.github.com/repos/frosty-dev/ss14-core/pulls/478 +- author: PointPNG + changes: + - message: "\u0424\u0438\u043A\u0441 \u0412\u0430\u043D\u0434\u0435\u0440\u0431\u043E\ + \u043A\u0441\u0430." + type: Fix + - message: "\u041E\u0431\u043D\u043E\u0432\u043B\u0435\u043D\u0438\u0435 \u0412\u0430\ + \u0439\u0442\u041C\u0443\u0441\u0430." + type: Add + id: 410 + time: '2024-07-23T02:03:31.0000000+00:00' + url: https://api.github.com/repos/frosty-dev/ss14-core/pulls/482 From b64eea4b3fc30b3adb8769416f87ce2265b7d7e9 Mon Sep 17 00:00:00 2001 From: Aviu00 <93730715+Aviu00@users.noreply.github.com> Date: Tue, 23 Jul 2024 15:34:12 +0000 Subject: [PATCH 5/6] - fix: Chameleon projector. (#484) --- .../Systems/ChameleonProjectorSystem.cs | 22 ++ .../_White/Overlays/ThermalVisionOverlay.cs | 8 +- .../Systems/ChameleonProjectorSystem.cs | 96 +------- .../Components/ChameleonDisguiseComponent.cs | 16 +- .../Components/ChameleonDisguisedComponent.cs | 24 ++ .../Components/ChameleonProjectorComponent.cs | 21 +- .../Systems/SharedChameleonProjectorSystem.cs | 211 +++++++++++++++++- .../chameleon-projector.ftl | 2 + .../Objects/Devices/chameleon_projector.yml | 22 +- 9 files changed, 294 insertions(+), 128 deletions(-) create mode 100644 Content.Shared/Polymorph/Components/ChameleonDisguisedComponent.cs diff --git a/Content.Client/Polymorph/Systems/ChameleonProjectorSystem.cs b/Content.Client/Polymorph/Systems/ChameleonProjectorSystem.cs index 5ba4878c6d..4acbf540f0 100644 --- a/Content.Client/Polymorph/Systems/ChameleonProjectorSystem.cs +++ b/Content.Client/Polymorph/Systems/ChameleonProjectorSystem.cs @@ -1,3 +1,4 @@ +using Content.Client.Smoking; using Content.Shared.Chemistry.Components; using Content.Shared.Polymorph.Components; using Content.Shared.Polymorph.Systems; @@ -10,14 +11,19 @@ public sealed class ChameleonProjectorSystem : SharedChameleonProjectorSystem [Dependency] private readonly SharedAppearanceSystem _appearance = default!; private EntityQuery _appearanceQuery; + private EntityQuery _spriteQuery; public override void Initialize() { base.Initialize(); _appearanceQuery = GetEntityQuery(); + _spriteQuery = GetEntityQuery(); SubscribeLocalEvent(OnHandleState); + + SubscribeLocalEvent(OnStartup); + SubscribeLocalEvent(OnShutdown); } private void OnHandleState(Entity ent, ref AfterAutoHandleStateEvent args) @@ -25,9 +31,25 @@ public sealed class ChameleonProjectorSystem : SharedChameleonProjectorSystem CopyComp(ent); CopyComp(ent); CopyComp(ent); + CopyComp(ent); // reload appearance to hopefully prevent any invisible layers if (_appearanceQuery.TryComp(ent, out var appearance)) _appearance.QueueUpdate(ent, appearance); } + + private void OnStartup(Entity ent, ref ComponentStartup args) + { + if (!_spriteQuery.TryComp(ent, out var sprite)) + return; + + ent.Comp.WasVisible = sprite.Visible; + sprite.Visible = false; + } + + private void OnShutdown(Entity ent, ref ComponentShutdown args) + { + if (_spriteQuery.TryComp(ent, out var sprite)) + sprite.Visible = ent.Comp.WasVisible; + } } diff --git a/Content.Client/_White/Overlays/ThermalVisionOverlay.cs b/Content.Client/_White/Overlays/ThermalVisionOverlay.cs index 72b6619d1a..fcc4863ff9 100644 --- a/Content.Client/_White/Overlays/ThermalVisionOverlay.cs +++ b/Content.Client/_White/Overlays/ThermalVisionOverlay.cs @@ -77,7 +77,7 @@ public sealed class ThermalVisionOverlay : Overlay var entities = _entity.EntityQueryEnumerator(); while (entities.MoveNext(out var uid, out _, out var sprite, out var xform)) { - if (!CanSee(uid)) + if (!CanSee(uid, sprite)) continue; var entity = uid; @@ -114,7 +114,7 @@ public sealed class ThermalVisionOverlay : Overlay Angle eyeRot) { var (uid, sprite, xform) = ent; - if (xform.MapID != map || HasOccluders(uid) || !CanSee(uid)) + if (xform.MapID != map || HasOccluders(uid) || !CanSee(uid, sprite)) return; var position = _transform.GetWorldPosition(xform); @@ -123,9 +123,9 @@ public sealed class ThermalVisionOverlay : Overlay sprite.Render(handle, eyeRot, rotation, position: position); } - private bool CanSee(EntityUid ent) + private bool CanSee(EntityUid ent, SpriteComponent sprite) { - return !_entity.HasComponent(ent); + return sprite.Visible && !_entity.HasComponent(ent); } private bool HasOccluders(EntityUid ent) diff --git a/Content.Server/Polymorph/Systems/ChameleonProjectorSystem.cs b/Content.Server/Polymorph/Systems/ChameleonProjectorSystem.cs index 1586973a21..ab12f2764c 100644 --- a/Content.Server/Polymorph/Systems/ChameleonProjectorSystem.cs +++ b/Content.Server/Polymorph/Systems/ChameleonProjectorSystem.cs @@ -1,99 +1,5 @@ -using Content.Server.Polymorph.Components; -using Content.Shared.Actions; -using Content.Shared.Construction.Components; -using Content.Shared.Hands; -using Content.Shared.Mobs; -using Content.Shared.Mobs.Components; -using Content.Shared.Mobs.Systems; -using Content.Shared.Polymorph; -using Content.Shared.Polymorph.Components; using Content.Shared.Polymorph.Systems; -using Content.Shared.StatusIcon.Components; -using Robust.Shared.Physics.Components; namespace Content.Server.Polymorph.Systems; -public sealed class ChameleonProjectorSystem : SharedChameleonProjectorSystem -{ - [Dependency] private readonly MetaDataSystem _meta = default!; - [Dependency] private readonly MobThresholdSystem _mobThreshold = default!; - [Dependency] private readonly PolymorphSystem _polymorph = default!; - [Dependency] private readonly SharedActionsSystem _actions = default!; - [Dependency] private readonly SharedAppearanceSystem _appearance = default!; - [Dependency] private readonly SharedTransformSystem _xform = default!; - - public override void Initialize() - { - base.Initialize(); - - SubscribeLocalEvent(OnEquippedHand); - SubscribeLocalEvent(OnToggleNoRot); - SubscribeLocalEvent(OnToggleAnchored); - } - - private void OnEquippedHand(Entity ent, ref GotEquippedHandEvent args) - { - if (!TryComp(ent, out var poly)) - return; - - _polymorph.Revert((ent, poly)); - args.Handled = true; - } - - public override void Disguise(ChameleonProjectorComponent proj, EntityUid user, EntityUid entity) - { - if (_polymorph.PolymorphEntity(user, proj.Polymorph) is not {} disguise) - return; - - // make disguise look real (for simple things at least) - var meta = MetaData(entity); - _meta.SetEntityName(disguise, meta.EntityName); - _meta.SetEntityDescription(disguise, meta.EntityDescription); - - var comp = EnsureComp(disguise); - comp.SourceEntity = entity; - comp.SourceProto = Prototype(entity)?.ID; - Dirty(disguise, comp); - - // no sechud trolling - RemComp(disguise); - - _appearance.CopyData(entity, disguise); - - var mass = CompOrNull(entity)?.Mass ?? 0f; - - // let the disguise die when its taken enough damage, which then transfers to the player - // health is proportional to mass, and capped to not be insane - if (TryComp(disguise, out var thresholds)) - { - // if the player is of flesh and blood, cap max health to theirs - // so that when reverting damage scales 1:1 and not round removing - var playerMax = _mobThreshold.GetThresholdForState(user, MobState.Dead).Float(); - var max = playerMax == 0f ? proj.MaxHealth : Math.Max(proj.MaxHealth, playerMax); - - var health = Math.Clamp(mass, proj.MinHealth, proj.MaxHealth); - _mobThreshold.SetMobStateThreshold(disguise, health, MobState.Critical, thresholds); - _mobThreshold.SetMobStateThreshold(disguise, max, MobState.Dead, thresholds); - } - - // add actions for controlling transform aspects - _actions.AddAction(disguise, proj.NoRotAction); - _actions.AddAction(disguise, proj.AnchorAction); - } - - private void OnToggleNoRot(Entity ent, ref DisguiseToggleNoRotEvent args) - { - var xform = Transform(ent); - xform.NoLocalRotation = !xform.NoLocalRotation; - } - - private void OnToggleAnchored(Entity ent, ref DisguiseToggleAnchoredEvent args) - { - var uid = ent.Owner; - var xform = Transform(uid); - if (xform.Anchored) - _xform.Unanchor(uid, xform); - else - _xform.AnchorEntity((uid, xform)); - } -} +public sealed class ChameleonProjectorSystem : SharedChameleonProjectorSystem; diff --git a/Content.Shared/Polymorph/Components/ChameleonDisguiseComponent.cs b/Content.Shared/Polymorph/Components/ChameleonDisguiseComponent.cs index 2b9fba7b39..282106b8f6 100644 --- a/Content.Shared/Polymorph/Components/ChameleonDisguiseComponent.cs +++ b/Content.Shared/Polymorph/Components/ChameleonDisguiseComponent.cs @@ -1,3 +1,4 @@ +using Content.Shared.Polymorph.Systems; using Robust.Shared.GameStates; using Robust.Shared.Prototypes; @@ -7,9 +8,22 @@ namespace Content.Shared.Polymorph.Components; /// Component added to disguise entities. /// Used by client to copy over appearance from the disguise's source entity. /// -[RegisterComponent, NetworkedComponent, AutoGenerateComponentState(true)] +[RegisterComponent, NetworkedComponent, Access(typeof(SharedChameleonProjectorSystem))] +[AutoGenerateComponentState(true)] public sealed partial class ChameleonDisguiseComponent : Component { + /// + /// The user of this disguise. + /// + [DataField] + public EntityUid User; + + /// + /// The projector that created this disguise. + /// + [DataField] + public EntityUid Projector; + /// /// The disguise source entity for copying the sprite. /// diff --git a/Content.Shared/Polymorph/Components/ChameleonDisguisedComponent.cs b/Content.Shared/Polymorph/Components/ChameleonDisguisedComponent.cs new file mode 100644 index 0000000000..0b0b18b254 --- /dev/null +++ b/Content.Shared/Polymorph/Components/ChameleonDisguisedComponent.cs @@ -0,0 +1,24 @@ +using Content.Shared.Polymorph.Systems; +using Robust.Shared.GameStates; + +namespace Content.Shared.Polymorph.Components; + +/// +/// Added to a player when they use a chameleon projector. +/// Handles making them invisible and revealing when damaged enough or switching hands. +/// +[RegisterComponent, NetworkedComponent, Access(typeof(SharedChameleonProjectorSystem))] +public sealed partial class ChameleonDisguisedComponent : Component +{ + /// + /// The disguise entity parented to the player. + /// + [DataField] + public EntityUid Disguise; + + /// + /// For client, whether the user's sprite was previously visible or not. + /// + [DataField] + public bool WasVisible; +} diff --git a/Content.Shared/Polymorph/Components/ChameleonProjectorComponent.cs b/Content.Shared/Polymorph/Components/ChameleonProjectorComponent.cs index 239b5236f2..3e2966af7e 100644 --- a/Content.Shared/Polymorph/Components/ChameleonProjectorComponent.cs +++ b/Content.Shared/Polymorph/Components/ChameleonProjectorComponent.cs @@ -1,4 +1,3 @@ -using Content.Shared.Polymorph; using Content.Shared.Polymorph.Systems; using Content.Shared.Whitelist; using Robust.Shared.Prototypes; @@ -25,22 +24,26 @@ public sealed partial class ChameleonProjectorComponent : Component public EntityWhitelist? Blacklist; /// - /// Polymorph configuration for the disguise entity. + /// Disguise entity to spawn and use. /// [DataField(required: true)] - public PolymorphConfiguration Polymorph = new(); + public EntProtoId DisguiseProto = string.Empty; /// /// Action for disabling your disguise's rotation. /// [DataField] public EntProtoId NoRotAction = "ActionDisguiseNoRot"; + [DataField] + public EntityUid? NoRotActionEntity; /// /// Action for anchoring your disguise in place. /// [DataField] public EntProtoId AnchorAction = "ActionDisguiseAnchor"; + [DataField] + public EntityUid? AnchorActionEntity; /// /// Minimum health to give the disguise. @@ -54,6 +57,12 @@ public sealed partial class ChameleonProjectorComponent : Component [DataField] public float MaxHealth = 100f; + /// + /// Popup shown to the user when they try to disguise as an entity inside a container. + /// + [DataField] + public LocId ContainerPopup = "chameleon-projector-inside-container"; + /// /// Popup shown to the user when they try to disguise as an invalid entity. /// @@ -65,4 +74,10 @@ public sealed partial class ChameleonProjectorComponent : Component /// [DataField] public LocId SuccessPopup = "chameleon-projector-success"; + + /// + /// User currently disguised by this projector, if any + /// + [DataField] + public EntityUid? Disguised; } diff --git a/Content.Shared/Polymorph/Systems/SharedChameleonProjectorSystem.cs b/Content.Shared/Polymorph/Systems/SharedChameleonProjectorSystem.cs index c1abfc526f..9944c9ba32 100644 --- a/Content.Shared/Polymorph/Systems/SharedChameleonProjectorSystem.cs +++ b/Content.Shared/Polymorph/Systems/SharedChameleonProjectorSystem.cs @@ -1,49 +1,173 @@ using Content.Shared.Actions; +using Content.Shared.Construction.Components; +using Content.Shared.Coordinates; +using Content.Shared.Damage; +using Content.Shared.Damage.Systems; +using Content.Shared.Hands; using Content.Shared.Interaction; +using Content.Shared.Item; using Content.Shared.Polymorph; using Content.Shared.Polymorph.Components; using Content.Shared.Popups; -using Robust.Shared.Serialization.Manager; +using Content.Shared.Verbs; +using Content.Shared.Whitelist; +using Robust.Shared.Containers; +using Robust.Shared.Network; +using Robust.Shared.Physics.Components; using Robust.Shared.Prototypes; +using Robust.Shared.Serialization.Manager; using System.Diagnostics.CodeAnalysis; namespace Content.Shared.Polymorph.Systems; /// -/// Handles whitelist/blacklist checking. -/// Actual polymorphing and deactivation is done serverside. +/// Handles disguise validation, disguising and revealing. +/// Most appearance copying is done clientside. /// public abstract class SharedChameleonProjectorSystem : EntitySystem { + [Dependency] private readonly DamageableSystem _damageable = default!; + [Dependency] private readonly INetManager _net = default!; [Dependency] private readonly IPrototypeManager _proto = default!; [Dependency] private readonly ISerializationManager _serMan = default!; + [Dependency] private readonly MetaDataSystem _meta = default!; + [Dependency] private readonly SharedActionsSystem _actions = default!; + [Dependency] private readonly SharedAppearanceSystem _appearance = default!; + [Dependency] private readonly SharedContainerSystem _container = default!; [Dependency] private readonly SharedPopupSystem _popup = default!; + [Dependency] private readonly SharedTransformSystem _xform = default!; public override void Initialize() { base.Initialize(); + SubscribeLocalEvent(OnDisguiseInteractHand, before: [typeof(SharedItemSystem)]); + SubscribeLocalEvent(OnDisguiseDamaged); + SubscribeLocalEvent(OnDisguiseShutdown); + SubscribeLocalEvent(OnInteract); + SubscribeLocalEvent>(OnGetVerbs); + SubscribeLocalEvent(OnToggleNoRot); + SubscribeLocalEvent(OnToggleAnchored); + SubscribeLocalEvent(OnDeselected); + SubscribeLocalEvent(OnUnequipped); + SubscribeLocalEvent(OnProjectorShutdown); } + #region Disguise entity + + private void OnDisguiseInteractHand(Entity ent, ref InteractHandEvent args) + { + TryReveal(ent.Comp.User); + args.Handled = true; + } + + private void OnDisguiseDamaged(Entity ent, ref DamageChangedEvent args) + { + // anything that would damage both like an explosion gets doubled + // feature? projector makes your atoms weaker or some bs + if (args.DamageDelta is {} damage) + _damageable.TryChangeDamage(ent.Comp.User, damage); + } + + private void OnDisguiseShutdown(Entity ent, ref ComponentShutdown args) + { + _actions.RemoveProvidedActions(ent.Comp.User, ent.Comp.Projector); + } + + #endregion + + #region Projector + private void OnInteract(Entity ent, ref AfterInteractEvent args) { - if (!args.CanReach || args.Target is not {} target) + if (args.Handled || !args.CanReach || args.Target is not {} target) + return; + + args.Handled = true; + TryDisguise(ent, args.User, target); + } + + private void OnGetVerbs(Entity ent, ref GetVerbsEvent args) + { + if (!args.CanAccess) return; var user = args.User; - args.Handled = true; + var target = args.Target; + args.Verbs.Add(new UtilityVerb() + { + Act = () => + { + TryDisguise(ent, user, target); + }, + Text = Loc.GetString("chameleon-projector-set-disguise") + }); + } + + public bool TryDisguise(Entity ent, EntityUid user, EntityUid target) + { + if (_container.IsEntityInContainer(target)) + { + _popup.PopupClient(Loc.GetString(ent.Comp.ContainerPopup), target, user); + return false; + } if (IsInvalid(ent.Comp, target)) { _popup.PopupClient(Loc.GetString(ent.Comp.InvalidPopup), target, user); - return; + return false; } _popup.PopupClient(Loc.GetString(ent.Comp.SuccessPopup), target, user); - Disguise(ent.Comp, user, target); + Disguise(ent, user, target); + return true; } + private void OnToggleNoRot(Entity ent, ref DisguiseToggleNoRotEvent args) + { + if (ent.Comp.Disguised is not {} uid) + return; + + var xform = Transform(uid); + _xform.SetLocalRotationNoLerp(uid, 0, xform); + xform.NoLocalRotation = !xform.NoLocalRotation; + args.Handled = true; + } + + private void OnToggleAnchored(Entity ent, ref DisguiseToggleAnchoredEvent args) + { + if (ent.Comp.Disguised is not {} uid) + return; + + var xform = Transform(uid); + if (xform.Anchored) + _xform.Unanchor(uid, xform); + else + _xform.AnchorEntity((uid, xform)); + + args.Handled = true; + } + + private void OnDeselected(Entity ent, ref HandDeselectedEvent args) + { + RevealProjector(ent); + } + + private void OnUnequipped(Entity ent, ref GotUnequippedHandEvent args) + { + RevealProjector(ent); + } + + private void OnProjectorShutdown(Entity ent, ref ComponentShutdown args) + { + RevealProjector(ent); + } + + #endregion + + #region API + /// /// Returns true if an entity cannot be used as a disguise. /// @@ -56,10 +180,81 @@ public abstract class SharedChameleonProjectorSystem : EntitySystem /// /// On server, polymorphs the user into an entity and sets up the disguise. /// - public virtual void Disguise(ChameleonProjectorComponent comp, EntityUid user, EntityUid entity) + public void Disguise(Entity ent, EntityUid user, EntityUid entity) { + var proj = ent.Comp; + + // no spawning prediction sorry + if (_net.IsClient) + return; + + // reveal first to allow quick switching + TryReveal(user); + + // add actions for controlling transform aspects + _actions.AddAction(user, ref proj.NoRotActionEntity, proj.NoRotAction, container: ent); + _actions.AddAction(user, ref proj.AnchorActionEntity, proj.AnchorAction, container: ent); + + proj.Disguised = user; + + var disguise = SpawnAttachedTo(proj.DisguiseProto, user.ToCoordinates()); + + var disguised = AddComp(user); + disguised.Disguise = disguise; + Dirty(user, disguised); + + // make disguise look real (for simple things at least) + var meta = MetaData(entity); + _meta.SetEntityName(disguise, meta.EntityName); + _meta.SetEntityDescription(disguise, meta.EntityDescription); + + var comp = EnsureComp(disguise); + comp.User = user; + comp.Projector = ent; + comp.SourceEntity = entity; + comp.SourceProto = Prototype(entity)?.ID; + Dirty(disguise, comp); + + // item disguises can be picked up to be revealed, also makes sure their examine size is correct + CopyComp((disguise, comp)); + + _appearance.CopyData(entity, disguise); } + /// + /// Removes the disguise, if the user is disguised. + /// + public bool TryReveal(Entity ent) + { + if (!Resolve(ent, ref ent.Comp, false)) + return false; + + if (TryComp(ent.Comp.Disguise, out var disguise) + && TryComp(disguise.Projector, out var proj)) + { + proj.Disguised = null; + } + + var xform = Transform(ent); + xform.NoLocalRotation = false; + _xform.Unanchor(ent, xform); + + Del(ent.Comp.Disguise); + RemComp(ent); + return true; + } + + /// + /// Reveal a projector's user, if any. + /// + public void RevealProjector(Entity ent) + { + if (ent.Comp.Disguised is {} user) + TryReveal(user); + } + + #endregion + /// /// Copy a component from the source entity/prototype to the disguise entity. /// diff --git a/Resources/Locale/en-US/chameleon-projector/chameleon-projector.ftl b/Resources/Locale/en-US/chameleon-projector/chameleon-projector.ftl index 8a79516077..b525c9da1a 100644 --- a/Resources/Locale/en-US/chameleon-projector/chameleon-projector.ftl +++ b/Resources/Locale/en-US/chameleon-projector/chameleon-projector.ftl @@ -1,2 +1,4 @@ +chameleon-projector-inside-container = There's no room to scan that! chameleon-projector-invalid = You can't disguise as that! chameleon-projector-success = Projected new disguise. +chameleon-projector-set-disguise = Set Disguise diff --git a/Resources/Prototypes/Entities/Objects/Devices/chameleon_projector.yml b/Resources/Prototypes/Entities/Objects/Devices/chameleon_projector.yml index e021281021..c9d2dafad9 100644 --- a/Resources/Prototypes/Entities/Objects/Devices/chameleon_projector.yml +++ b/Resources/Prototypes/Entities/Objects/Devices/chameleon_projector.yml @@ -15,15 +15,12 @@ blacklist: components: - ChameleonDisguise # no becoming kleiner - - InsideEntityStorage # no clark kent going in phone booth and becoming superman - MindContainer # no - Pda # PDAs currently make you invisible /!\ - polymorph: - entity: ChameleonDisguise + disguiseProto: ChameleonDisguise - type: entity noSpawn: true - parent: BaseMob id: ChameleonDisguise name: Urist McKleiner components: @@ -31,20 +28,11 @@ - type: Sprite sprite: /Textures/Mobs/Species/Human/parts.rsi state: full - # so people can attempt to pick it up - - type: Item - # so it can take damage - # projector system sets health to be proportional to mass + - type: Transform + noRot: true # players rotation and anchor is used instead + - type: InteractionOutline + - type: Clickable - type: Damageable - - type: MobState - - type: MobThresholds - thresholds: - 0: Alive - 1: Critical - 200: Dead - - type: MovementSpeedModifier - baseWalkSpeed: 1 # precise movement for the perfect spot - baseSprintSpeed: 5 # the jig is up - type: ChameleonDisguise # actions From 003452b8e19f8bd9e6b111b716b1e3af7a015480 Mon Sep 17 00:00:00 2001 From: RavmorganButOnCocaine Date: Tue, 23 Jul 2024 15:35:17 +0000 Subject: [PATCH 6/6] Automatic changelog update --- Resources/Changelog/ChangelogWhite.yml | 9 +++++++++ 1 file changed, 9 insertions(+) diff --git a/Resources/Changelog/ChangelogWhite.yml b/Resources/Changelog/ChangelogWhite.yml index 64e562bfee..f842f812a5 100644 --- a/Resources/Changelog/ChangelogWhite.yml +++ b/Resources/Changelog/ChangelogWhite.yml @@ -6463,3 +6463,12 @@ id: 410 time: '2024-07-23T02:03:31.0000000+00:00' url: https://api.github.com/repos/frosty-dev/ss14-core/pulls/482 +- author: Aviu + changes: + - message: "\u0425\u0430\u043C\u0435\u043B\u0435\u043E\u043D \u043F\u0440\u043E\u0435\ + \u043A\u0442\u043E\u0440 \u0442\u0435\u043F\u0435\u0440\u044C \u0440\u0430\u0431\ + \u043E\u0442\u0430\u0435\u0442 \u043B\u0443\u0447\u0448\u0435." + type: Fix + id: 411 + time: '2024-07-23T15:34:13.0000000+00:00' + url: https://api.github.com/repos/frosty-dev/ss14-core/pulls/484